Rat CXCL10 / Crg-2 Gene ORF cDNA clone expression plasmid,N terminal HA tag

Catalog Number:RGB939-NY

Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
297bp
Gene Synonym
IP-10,Scyb10
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Rat chemokine (C-X-C motif) ligand 10 Gene ORF cDNA clone expression plasmid,N terminal HA tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-HA
Restriction Site
Protein Tag
HA
Tag Sequence
TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
HA Tag Information

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
CXCL10, also known as crg-2, is a chemokine of the CXC subfamily and ligand for the receptor CXCR3. CXC chemokines are particularly significant for leukocyte infiltration in inflammatory diseases. CXCL10 has a three-dimensional crystal structure. Its signaling is mediated by the g protein-coupled receptor CXCR3, which is expressed on activated T cells and plays an important role in directing the migration of T cells, especially during Th1 responses. Binding of CXCL10 to CXCR3 results in pleiotropic effects, including stimulation of monocytes, natural killer and T-cell migration, and modulation of adhesion molecule expression. It is chemotactic for monocytes and T-lymphocytes. CXCL10 can be secreted by several cell types in response to IFN-γ. Baseline pre-treatment plasma levels of CXCL10 are elevated in patients chronically infected with hepatitis C virus (HCV) of genotypes 1 or 4 who do not achieve a sustained viral response (SVR) after completion of antiviral therapy.
References
  • O'Donovan N, et al. (1999) Physical mapping of the CXC chemokine locus on human chromosome 4. Cytogenet. Cell Genet. 84(1-2):39-42.
  • Swaminathan GJ, et al. (2003) Crystal structures of oligomeric forms of the IP-10/CXCL10 chemokine. Structure. 11(5):521-32.
  • Booth V, et al. (2002) The CXCR3 binding chemokine IP-10/CXCL10: structure and receptor interactions. Biochemistry. 41(33):10418-25.
  • TOP