Rat CXCL1 Gene ORF cDNA clone expression plasmid,without any tag

Catalog Number:RGB938-UT

Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
291bp
Gene Synonym
Gro1, CINC-1, Cxcl1
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Rat chemokine (C-X-C motif) ligand 1 (melanoma growth stimulating activity, alpha) Gene ORF cDNA clone expression plasmid,without any tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-untagged
Restriction Site
Protein Tag
Tag Sequence
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
The Chemokine (C-X-C motif) Ligand 1, CXCL1, is a small cytokine belonging to the CXC chemokine family that was previously called GRO1 oncogene, GRO?, KC, Neutrophil-activating protein 3 (NAP-3) and melanoma growth stimulating activity, alpha (MSGA-a). CXCL1 already known to be important in osteoarthritis (OA), as a novel target gene of transcription factor AP-2? in chondrocytes and support the important role of AP-2? in cartilage. CXCL1 is a potent neutrophil chemoattractant with recognized roles in angiogenesis and inflammation. CXCL1 is a novel immediate PTH/PTHrP-responsive gene. CXCL1 may act as a chemoattractant for osteoclast precursors. CXCL1 may also have important pro-nociceptive effects via its direct actions on sensory neurons, and may induce long-term changes that involve protein synthesis. CXCL1 plays a critical nonredundant role in the development of experimental Lyme arthritis and carditis via CXCR2-mediated recruitment of neutrophils into the site of infection. CXCL1 functions through CXCR2 to transactivate the EGFR by proteolytic cleavage of HB-EGF, leading to activation of MAPK signalling and increased proliferation of epithelial ovarian cancer (EOC) cells. It might limit tumor growth by reinforcing senescence early in tumorigenesis. Thus, CXCL1 plays a role in spinal cord development by inhibiting the migration of oligodendrocyte precursors and is involved in the processes of angiogenesis, inflammation, wound healing, and tumorigenesis.
References
  • Wang JG, et al. (2008) The chemokine CXCL1/growth related oncogene increases sodium currents and neuronal excitability in small diameter sensory neurons. Mol Pain. 4: 38.
  • Acosta JC, et al. (2009) A role for CXCR2 in senescence, but what about in cancer? Cancer Res. 69(6): 2167-70.
  • Onan D, et al. (2009) The chemokine Cxcl1 is a novel target gene of parathyroid hormone (PTH)/PTH-related protein in committed osteoblasts. Endocrinology. 150(5): 2244-53.
  • Ritzman AM, et al. (2010) The chemokine receptor CXCR2 ligand KC (CXCL1) mediates neutrophil recruitment and is critical for development of experimental Lyme arthritis and carditis. Infect Immun. 78(11): 4593-600.
  • Bolitho C, et al. (2010) The chemokine CXCL1 induces proliferation in epithelial ovarian cancer cells by transactivation of the epidermal growth factor receptor. Endocr Relat Cancer. 17(4): 929-40.
  • Wenke AK, et al. (2011) The transcription factor AP-2? regulates CXCL1 during cartilage development and in osteoarthritis. Osteoarthritis Cartilage. 19(2): 206-12.
  • TOP