Rat CSRP1 Gene ORF cDNA clone expression plasmid,C terminal HA tag

Catalog Number:RGB881-CY

Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
582bp
Gene Synonym
Csrp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Rat cysteine and glycine-rich protein 1 Gene ORF cDNA clone expression plasmid,C terminal HA tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-HA
Restriction Site
Protein Tag
HA
Tag Sequence
TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
HA Tag Information

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Cysteine and glycine-rich protein 1, also known as Cysteine-rich protein 1, CSRP1 and CSRP, is a member of the CSRP family which may be involved in regulatory processes important for development and cellular differentiation. CSRP1 contains two LIM zinc-binding domains. The LIM / double zinc-finger motif found in CSRP1 is found in a group of proteins with critical functions in gene regulation, cell growth, and somatic differentiation. Zebrafish CSRP1 is expressed in the mesendoderm and its derivatives. CSRP1 interacts with Dishevelled 2 (Dvl2) and Diversin (Div), which control cell morphology and other dynamic cell behaviors via the noncanonical Wnt and JNK pathways. When CSRP1 message is knocked down, abnormal convergent extension cell movement is induced, resulting in severe deformities in midline structures. In addition, cardiac bifida is induced as a consequence of defects in cardiac mesoderm cell migration. CSRP1 acts as a key molecule of the noncanonical Wnt pathway, which orchestrates cell behaviors during dynamic morphogenetic movements of tissues and organs.
References
  • Wimmer,U. et al., 2005, Nucleic acids Res. 33 (18):5715-27.
  • Miyasaka, KY.et al., 2007, Proc Natl Acad Sci USA. 104 (27): 11274-9.
  • Zhou,C.Z. et al., 2008,Chin Med J. 121 (24): 2479-86.
  • Lilly,B. et al., 2010, Arterioscler Thromb Vasc Biol. 30 (4):694-701. 
  • TOP