Rat COQ7 Gene ORF cDNA clone expression plasmid,C terminal HA tag

Catalog Number:RGB780-CY

Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
654bp
Gene Synonym
Coq7
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Rat coenzyme Q7 homolog, ubiquinone (yeast) Gene ORF cDNA clone expression plasmid,C terminal HA tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-HA
Restriction Site
Protein Tag
HA
Tag Sequence
TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
HA Tag Information

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Ubiquinone biosynthesis protein COQ7 homolog, also known as Coenzyme Q biosynthesis protein 7 homolog, Timing protein clk-1 homolog and COQ7, is a mitochondrion inner membrane and peripheral membrane protein which belongs to the COQ7 family. It is expressed dominantly in heart and skeletal muscle. COQ7 is synthesized as a preprotein that is imported into the mitochondrial matrix, where the sequence is cleaved off and the mature protein becomes loosely associated with the inner membrane. This enzyme is responsible for the hydroxylation of 5-demethoxyubiquinone to 5-hydroxyubiquinone. Human COQ7 protein is mostly helical, and contains an alpha-helical membrane insertion. It has a potential N-glycosylation site, a phosphorylation site for protein kinase C and another for casein kinase II, and three N-myristoylation sites. COQ7 is involved in lifespan determination in ubiquinone-independent manner. It is also involved in ubiquinone biosynthesis. COQ7 is potential central metabolic regulator.
References
  • Ewbank J.J., et al., 1997, Science. 275: 980-3.
  • Vajo Z., et al., 1999, Mamm. Genome. 10: 1000-4.
  • Wiemann S., et al., 2001, Genome Res. 11: 422-35.
  • Stenmark,P. et al., 2001, J Biol Chem. 276 (36): 33297-300.
  • Martin J., et al., 2004, Nature. 432: 988-94. 
  • TOP