Rat Contactin 2/CNTN2 Gene ORF cDNA clone expression plasmid,N terminal Myc tag

Gene

Species

Rat

NCBI Ref Seq

NM_012884.1

RefSeq ORF Size

3123bp

Gene Synonym

Tax, TAG1, TAG-1, TAG-564, Cntn2

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Rat contactin 2 (axonal) Gene ORF cDNA clone expression plasmid,N terminal Myc tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-N-Myc

Restriction Site

Protein Tag

Myc

Tag Sequence

GAGCAGAAACTCATCTCAGAAGAGGATCTG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

Contactins are a subgroup of molecules belonging to the immunoglobulin superfamily that are expressed exclusively in the nervous system. The subgroup consists of six members: Contactin-1, Contactin-2(TAG-1), Contactin-3(BIG-1), BIG-2, Contactin-5(NB-2) and NB-3. Since their identification in the late 1980s, Contactin-1 and Contactin-2 have been studied extensively. Axonal expression and the neurite extension activity of Contactin-1 and Contactin-2 attracted researchers to study the function of these molecules in axon guidance during development. Contactin-1 and Contactin-2 have come to be known as the principal molecules in the function and maintenance of myelinated neurons. In contrast, the function of the other four members of this subgroup remained unknown until recently. Contactin-2, also known as CNTN2, is a glycosylphosphatidylinositol (GPI)-anchored neuronal membrane protein that functions as a cell adhesion molecule. The human, rat, and chicken Contactin-2 are alternatively known as TAX1 (transiently-expressed axonal glycoprotein), TAG1 (transient axonal glycoprotein), and axonin-1, respectively. Human Contactin-2 shares approximately 91% and 75% amino acid sequence identity with rat and chicken Contactin-2, respectively. Contactin-2 is expressed by a subset of neuronal populations in the developing central nervous system (CNS) and peripheral nervous system (PNS). Contactin-2 is also expressed by oligodendrocytes and Schwann cells, which are myelinating glial cells of the CNS and PNS, respectively. Contactin-2 may play a role in the formation of axon connections in the developing nervous system. Contactin-2 is also involved in glial tumorigenesis and may provide a potential target for therapeutic intervention. During embryonic development, Contactin-2 interacts either in a homophilic, or heterophilic fashion with various transmembrane proteins.

References

Kyriakopoulou K, et al. (2002) A combination of chain and neurophilic migration involving the adhesion molecule TAG-1 in the caudal medulla. Development 129 (2):287-96.

Traka M, et al. (2002) The neuronal adhesion protein TAG-1 is expressed by Schwann cells and oligodendrocytes and is localized to the juxtaparanodal region of myelinated fibers. J Neurosci. 22(8):3016-24.

Traka M, et al. (2003) Association of TAG-1 with Caspr2 is essential for the molecular organization of juxtaparanodal regions of myelinated fibers. J Cell Biol. 162(6):1161-72.

Soares S, et al. (2005) Neuronal and glial expression of the adhesion molecule TAG-1 is regulated after peripheral nerve lesion or central neurodegeneration of adult nervous system. Eur J Neurosci. 21(5):1169-80.

Derfuss T, et al. (2009) Contactin-2/TAG-1-directed autoimmunity is identified in multiple sclerosis patients and mediates gray matter pathology in animals. Proc Natl Acad Sci U S A. 106(20):8302-7.

Catalog Number:RGB762-NM