Rat Complement Factor H Gene ORF cDNA clone expression plasmid,C terminal Myc tag

Gene

Species

Rat

NCBI Ref Seq

BC089845.1

RefSeq ORF Size

1182bp

Gene Synonym

Fh

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Rat complement factor H Gene ORF cDNA clone expression plasmid,C terminal Myc tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-C-Myc

Restriction Site

Protein Tag

Myc

Tag Sequence

GAGCAGAAACTCATCTCAGAAGAGGATCTG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

Complement factor H, also known as H factor 1, and CFH, is a sialic acid containing glycoprotein that plays an integral role in the regulation of the complement-mediated immune system that is involved in microbial defense, immune complex processing, and programmed cell death. Factor H protects host cells from injury resulting from unrestrained complement activation. CFH regulates complement activation on self cells by possessing both cofactor activity for the Factor I mediated C3b cleavage, and decay accelerating activity against the alternative pathway C3 convertase, C3bBb. CFH protects self cells from complement activation but not bacteria/viruses. Due to the central role that CFH plays in the regulation of complement, there are many clinical implications arrising from aberrant CFH activity. Mutations in the Factor H gene are associated with severe and diverse diseases including the rare renal disorders hemolytic uremic syndrome (HUS) and membranoproliferative glomerulonephritis (MPGN) also termed dense deposit disease (DDD), membranoproliferative glomuleronephritis type II or dense deposit disease, as well as the more frequent retinal disease age related macular degeneration (AMD). In addition to its complement regulatory activities, factor H has multiple physiological activities and 1) acts as an extracellular matrix component, 2) binds to cellular receptors of the integrin type, and 3) interacts with a wide selection of ligands, such as the C-reactive protein, thrombospondin, bone sialoprotein, osteopontin, and heparin.

References

Zipfel PF. (2001) Complement factor H: physiology and pathophysiology. Semin Thromb Hemost. 27(3): 191-9.

Zipfel PF, et al. (2008) The complement fitness factor H: role in human diseases and for immune escape of pathogens, like pneumococci. Vaccine. 26 Suppl 8: I67-74.

Ferreira VP, et al. (2010) Complement control protein factor H: the good, the bad, and the inadequate. Mol Immunol. 47(13): 2187-97.

Donoso LA, et al. (2010) The role of complement Factor H in age-related macular degeneration: a review. Surv Ophthalmol. 55(3): 227-46.

Catalog Number:RGB759-CM