Rat Coagulation Factor III / Tissue Factor / CD142 Gene ORF cDNA clone expression plasmid,C terminal OFP tag

Catalog Number:RGB719-CO

Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
888bp
Gene Synonym
MGC93621, F3
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Rat coagulation factor III (thromboplastin, tissue factor) Gene ORF cDNA clone expression plasmid,C terminal OFP tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-OFPSpark
Restriction Site
Protein Tag
OFPSpark
Tag Sequence
GATAGCACTGAG……CACCTGTTCCAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
OFPSpark Tag Information

OFPSpark is a red (orange) fluorescent protein (excitation/emission maxima are 549 and 566 nm, respectively) derived from DsRed. Possessing high photostability and pH stability, OFPSpark is more than twice brighter than mOrange2. Fast OFPSpark maturation makes it clearly detectable in mammalian cells as early as within 8 hrs after transfection. OFPSpark can be expressed and detected in a wide range of organisms. Mammalian cells transiently transfected with OFPSpark expression vectors produce bright fluorescence in 8 hrs after transfection. No cytotoxic effects or visible protein aggregation are observed. For its monomer structure, OFPSpark performs well in some fusions and protein labeling applications.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Tissue factor (TF), also known as coagulation factor III, F3, and CD142, is a single-pass type I membrane protein which belongs to the tissue factor family. Tissue factor is one of the proteins that participate in hemostatic and inflammatory processes. Activated monocytes present in the liver increase expression of tissue factor, and while accumulating in the organ they can intensify inflammation. Tissue factor is the protein that activates the blood clotting system by binding to, and activating, the plasma serine protease, factor VIIa, following vascular injury. Tissue factor is not only the main physiological initiator of normal blood coagulation, but is also important in the natural history of solid malignancies in that it potentiates metastasis and angiogenesis and mediates outside-in signalling. Tissue factor is expressed constitutively by many tissues which are not in contact with blood and by other cells upon injury or activation; the latter include endothelial cells, tissue macrophages, and peripheral blood monocytes. Coagulation Factor III is a transmembrane glycoprotein that localizes the coagulation serine protease factor VII/VIIa (FVII/VIIa) to the cell surface. The primary function of TF is to activate the clotting cascade. The TF:FVIIa complex also activates cells by cleavage of a G-protein coupled receptor called protease-activated receptor 2 (PAR2). TF is expressed by tumor cells and contributes to a variety of pathologic processes, such as thrombosis, metastasis, tumor growth, and tumor angiogenesis. As a key regulator of haemostasis and angiogenesis, it is also involved in the pathology of several diseases, including cardiovascular, inflammatory and neoplastic conditions.
References
  • Morrissey JH. (2004) Tissue factor: a key molecule in hemostatic and nonhemostatic systems. Int J Hematol. 79(2): 103-8.
  • Milsom C, et al. (2008) Tissue factor and cancer. Pathophysiol Haemost Thromb. 36(3-4): 160-76.
  • Kasthuri RS, et al. (2009) Role of tissue factor in cancer. J Clin Oncol. 27(29): 4834-8.
  • TOP