Rat Coagulation Factor II/F2 Gene ORF cDNA clone expression plasmid,C terminal Flag tag

Catalog Number:RGB718-CF

Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
1854bp
Gene Synonym
F2
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Rat coagulation factor II Gene ORF cDNA clone expression plasmid,C terminal Flag tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-FLAG
Restriction Site
Protein Tag
Flag
Tag Sequence
GATTACAAGGATGACGACGATAAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Flag Tag Information

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Coagulation Factor II Protein (FII, F2 Protein or Prothrombin) is proteolytically cleaved to form thrombin in the first step of the coagulation cascade which ultimately results in the stemming of blood loss. Coagulation Factor II Protein (FII, F2 Protein) also plays a role in maintaining vascular integrity during development and postnatal life. Prothrombin / Coagulation Factor II is activated on the surface of a phospholipid membrane that binds the amino end of prothrombin / Coagulation Factor II and factor Va and Xa in Ca-dependent interactions; factor Xa removes the activation peptide and cleaves the remaining part into light and heavy chains. The activation process starts slowly because factor V itself has to be activated by the initial, small amounts of thrombin. Prothrombin / Coagulation Factor II is expressed by the liver and secreted in plasma. Defects in prothrombin / Coagulation Factor II are the cause of factor II deficiency (FA2D). It is very rare blood coagulation disorder characterized by mucocutaneous bleeding symptoms. The severity of the bleeding manifestations correlates with blood factor II levels. Defects in Coagulation Factor II are also a cause of susceptibility to thrombosis. It is a multifactorial disorder of hemostasis characterized by abnormal platelet aggregation in response to various agents and recurrent thrombi formation.
References
  • Danneberg J, et al. (1998) Reliable genotyping of the G-20210-A mutation of Coagulation Factor II (prothrombin). Clin Chem. 44(2): 349-51.
  • Redondo M, et al. (1999) Coagulation Factor s II, V, VII, and X, prothrombin gene 20210GA transition, and factor V Leiden in coronary artery disease: high factor V clotting activity is an independent risk factor for myocardial infarction. Arterioscler Thromb Vasc Biol. 19(4): 1020-5.
  • Miletich JP, et al. (1980) The synthesis of sulfated dextran beads for isolation of human plasma Coagulation Factor s II, IX, and X. Anal Biochem. 105(2): 304-10.
  • TOP