Rat CNTFR Gene ORF cDNA clone expression plasmid,C terminal Flag tag

Catalog Number:RGB711-CF

Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
1119bp
Gene Synonym
Cntfr
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Rat ciliary neurotrophic factor receptor Gene ORF cDNA clone expression plasmid,C terminal Flag tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-FLAG
Restriction Site
Protein Tag
Flag
Tag Sequence
GATTACAAGGATGACGACGATAAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Flag Tag Information

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Ciliary neurotrophic factor(CNTF) is a member of the cytokine family. It is a polypeptide hormone that have functions in promoting neurotransmitter synthesis and neurite outgrowth in certain neuronal populations. It's actions appear to be restricted to the nervous system. Ciliary neurotrophic factor(CNTF) has biological effects through the activation of a multi-subunit receptor complex, consisting of an extracelluar CNTF binding subunit(CNTFα) and two transmembrane signal transduction proteins: glycoprotein gp130 and LIF receptor. CNTF is considered as a potent survival factor of neurons and oligodendrocytes and may be relevant in reducing tissue destruction during inflammatory attacks. CNTF is also a survival factor for neurons of the peripheral sensory sympathetic, and ciliary ganglia. It has been reported that CNTF could be an agent that has therapeutic potential and possibly induces differentiation of large multipolar ganglionic phenotype in a subset of progenitors.
References
  • Dutt K, et al. (2010) Ciliary neurotrophic factor: a survival and differentiation inducer in human retinal progenitors. In Vitro Cell Dev Biol Anim. 46 (7) : 635-46.
  • Lam A, et al. ( 1991) Sequence and structural organization of the human gene encoding ciliary neurotrophic factor. Gene 102 (2) : 271-6.
  • Bazan JF. ( 1991) Neuropoietic cytokines in the hematopoietic fold. Neuron 7 (2) : 197-208.
  • TOP