Rat CLP1 / COLEC12 Gene ORF cDNA clone expression plasmid,C terminal HA tag

Gene

Species

Rat

NCBI Ref Seq

NM_001025721.1

RefSeq ORF Size

2229bp

Gene Synonym

MGC114569, Colec12

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Rat collectin sub-family member 12 Gene ORF cDNA clone expression plasmid,C terminal HA tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-C-HA

Restriction Site

Protein Tag

HA

Tag Sequence

TATCCTTACGACGTGCCTGACTACGCC

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

HA Tag Information

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

CLP1, also known as COLEC12, is a scavenger receptor that displays several functions associated with host defense. It contains 1 C-type lectin domain and 3 collagen-like domains. CLP1 is strongly expressed in placenta and moderately expressed in heart, skeletal muscle, small intestine and lung. It promotes binding and phagocytosis of Gram-positive, Gram-negative bacteria and yeast. CLP1 mediates the recognition, internalization and degradation of oxidatively modified low density lipoprotein (oxLDL) by vascular endothelial cells. It binds to several carbohydrates including Gal-type ligands, D-galactose, L- and D-fucose, GalNAc, T and Tn antigens in a calcium-dependent manner and internalizes specifically GalNAc in nurse-like cells. It binds also to sialyl Lewis X or a trisaccharide and asialo-orosomucoid (ASOR). CLP1 may also play a role in the clearance of amyloid beta in Alzheimer disease.

References

Ramirez A, et al. (2008) Human RNA 5'-kinase (hClp1) can function as a tRNA splicing enzyme in vivo. RNA. 14(9):1737-45.

Danielsen JM, et al.. (2011) Mass spectrometric analysis of lysine ubiquitylation reveals promiscuity at site level. Mol Cell Proteomics. 10(3):M110.003590.

Kim W, et al. (2011) Systematic and quantitative assessment of the ubiquitin-modified proteome. Mol Cell. 44(2):325-40.

Catalog Number:RGB663-CY