Rat CLEC4A3 Gene ORF cDNA clone expression plasmid,C terminal Myc tag

Catalog Number:RGB644-CM

Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
714bp
Gene Synonym
Dcir3, Clec4a3
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Rat C-type lectin domain family 4, member A3 Gene ORF cDNA clone expression plasmid,C terminal Myc tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-Myc
Restriction Site
Protein Tag
Myc
Tag Sequence
GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
CLEC4A3 contains 1 C-type lectin domain and belongs to the C-type lectin-like domain-containing (CLEC) family. Lectins are proteins that are able to recognize and bind with specific carbohydrate molecules. C-type lectins are an important group of proteins found in the immune system of animals. These lectins are named C-type because of their calcium dependent carbohydrate recognition domain (CRD). In the immune system, C-type lectins act as recognition molecules by binding to foreign microorganisms. They also promote the movement and selective adhesion of white blood cells.
References
  • Gibbs RA, et al. (2004) Genome sequence of the Brown Norway rat yields insights into mammalian evolution. Nature. 428:493-521.
  • Carninci P, et al. (1999) High-efficiency full-length cDNA cloning. Methods Enzymol. 303:19-44.
  • Shibata K, et al. (2000) RIKEN integrated sequence analysis (RISA) system--384-format sequencing pipeline with 384 multicapillary sequencer. Genome Res. 10:1757-71.
  • TOP