Rat CLEC14A Gene ORF cDNA clone expression plasmid,C terminal Myc tag

Gene

Species

Rat

NCBI Ref Seq

NM_001014077.1

RefSeq ORF Size

1407bp

Gene Synonym

RGD1306232, Clec14a

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Rat C-type lectin domain family 14, member A Gene ORF cDNA clone expression plasmid,C terminal Myc tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-C-Myc

Restriction Site

Protein Tag

Myc

Tag Sequence

GAGCAGAAACTCATCTCAGAAGAGGATCTG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

C-type lectin domain family 14 member A, also known as Epidermal growth factor receptor 5 and CLEC14A, is a member of the C-type lectin domain (CTLD) family that contains one c-type lectin domain and one EGF-like domain. Mouse CLEC14A is a 459 amino acid single-pass type I membrane protein. The superfamily of proteins containing C-type lectin-like domains (CTLDs) is a large group of extracellular Metazoan proteins with diverse functions. The CTLD structure has a characteristic double-loop ('loop-in-a-loop') stabilized by two highly conserved disulfide bridges located at the bases of the loops, as well as a set of conserved hydrophobic and polar interactions. Members of the C-type lectin/C-type lectin-like domain (CTL/CTLD) superfamily share a common fold and are involved in a variety of functions, such as generalized defense mechanisms against foreign agents, discrimination between healthy and pathogen-infected cells, and endocytosis and blood coagulation. Genome-level studies on human, elegans and melanogaster demonstrated almost complete divergence among invertebrate and mammalian families of CTLD-containing proteins (CTLDcps). The vertebrate CTLDcp families were essentially formed early in vertebrate evolution and are completely different from the invertebrate families. The composition of the CTLDcp superfamily in fish and mammals suggests that large scale duplication events played an important role in the evolution of vertebrates.

References

Ebner S, et al. (2003) Evolutionary analysis reveals collective properties and specificity in the C-type lectin and lectin-like domain superfamily. Proteins. 53(1): 44-55.

Zelensky AN, et al. (2005) The C-type lectin-like domain superfamily. Gready JE. FEBS J. 272(24): 6179-217.

Catalog Number:RGB633-CM