Rat CD98/SLC3A2/4F2HC Gene ORF cDNA clone expression plasmid,C terminal OFP tag

Catalog Number:RGB408-CO

Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
1584bp
Gene Synonym
Mdu1, Slc3a2
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Rat solute carrier family 3 (activators of dibasic and neutral amino acid transport), member 2 Gene ORF cDNA clone expression plasmid,C terminal OFP tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-OFPSpark
Restriction Site
HindIII + XbaI (6kb + 1.67kb)
Protein Tag
OFPSpark
Tag Sequence
GATAGCACTGAG……CACCTGTTCCAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
OFPSpark Tag Information

OFPSpark is a red (orange) fluorescent protein (excitation/emission maxima are 549 and 566 nm, respectively) derived from DsRed. Possessing high photostability and pH stability, OFPSpark is more than twice brighter than mOrange2. Fast OFPSpark maturation makes it clearly detectable in mammalian cells as early as within 8 hrs after transfection. OFPSpark can be expressed and detected in a wide range of organisms. Mammalian cells transiently transfected with OFPSpark expression vectors produce bright fluorescence in 8 hrs after transfection. No cytotoxic effects or visible protein aggregation are observed. For its monomer structure, OFPSpark performs well in some fusions and protein labeling applications.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
4F2 cell-surface antigen heavy chain, also known as 4F2 heavy chain antigen, Lymphocyte activation antigen 4F2 large subunit, CD98, SLC3A2 and MDU1, is a single-pass type I I membrane protein which belongs to the SLC3A transporter family. SLC3A2 / MDU1 is expressed ubiquitously in all tissues tested with highest levels detected in kidney, placenta and testis and weakest level in thymus. During gestation, expression in the placenta is significantly stronger at full-term than at the mid-trimester stage. SLC3A2 / MDU1 is expressed in HUVECS and at low levels in resting peripheral blood T-lymphocytes and quiescent fibroblasts. It is expressed in fetal liver and in the astrocytic process of primary astrocytic gliomas. SLC3A2 / MDU1 is also expressed in retinal endothelial cells and in the intestinal epithelial cell line Caco2-BBE. SLC3A2 / MDU1 is required for the function of light chain amino-acid transporters. It involved in sodium-independent, high-affinity transport of large neutral amino acids such as phenylalanine, tyrosine, leucine, arginine and tryptophan. SLC3A2 / MDU1 is involved in guiding and targeting of LAT1 and LAT2 to the plasma membrane. When associated with SLC7A6 or SLC7A7, SLC3A2 / MDU1 acts as an arginine/glutamine exchanger, following an antiport mechanism for amino acid transport, influencing arginine release in exchange for extracellular amino acids. SLC3A2 / MDU1 plays a role in nitric oxide synthesis in human umbilical vein endothelial cells (HUVECs) via transport of L-arginine. It is required for normal and neoplastic cell growth. When associated with SLC7A5/LAT1, SLC3A2 / MDU1 is also involved in the transport of L-DOPA across the blood-brain barrier, and that of thyroid hormones triiodothyronine (T3) and thyroxine (T4) across the cell membrane in tissues such as placenta.
References
  • Torrents D. et al., 1998, J Biol Chem. 273: 32437-45.
  • Pfeiffer R. et al., 1999, EMBO J. 18: 49-57.
  • Broeer A. et al., 2000, Biochem J. 349: 787-95.
  • Yanagida O. et al., 2001, Biochim Biophys Acta. 1514: 291-302.
  • Broeer A. et al., 2001, Biochem J. 355: 725-31.
  • Fort J. et al., 2007, J Biol Chem. 282: 31444-52.
  • Mayya V. et al., 2009, Sci Signal. 2: RA46-RA46.
  • TOP