Rat CD95/APO-1/TNFRSF6 Gene ORF cDNA clone expression plasmid,N terminal His tag

Catalog Number:RGB403-NH

Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
975bp
Gene Synonym
Tnfrsf6, Fas
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Rat Fas (TNF receptor superfamily, member 6) Gene ORF cDNA clone expression plasmid,N terminal His tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-His
Restriction Site
Protein Tag
His
Tag Sequence
CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
His Tag Information

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
CD95 (APO-1/Fas) is an important inducer of the extrinsic apoptosis signaling pathway and therapy induced apoptosis of many tumor cells has been linked to the activity of CD95. is a prototype death receptor characterized by the presence of an 80 amino acid death domain in its cytoplasmic tail. This domain is essential for the recruitment of a number of signaling components upon activation by either agonistic anti-CD95 antibodies or cognate CD95 ligand that initiate apoptosis. The complex of proteins that forms upon triggering of CD95 is called the death-inducting signaling complex (DISC). The DISC consists of an adaptor protein and initiator caspases and is essential for induction of apoptosis. CD95 is also crucial for the negative selection of B cells within the germinal center (GC). Impairment of CD95-mediated apoptosis results in defective affinity maturation and the persistence of autoreactive B-cell clones. Changes in the expression of CD95 and/or its ligand CD95L are frequently found in human cancer. The downregulation or mutation of CD95 has been proposed as a mechanism by which cancer cells avoid destruction by the immune system through reduced apoptosis sensitivity. Thus, CD95 has therefore been viewed as a tumor suppressor. CD95 has been reported to be involved in the activation of NF-kappaB, MAPK3/ERK1, MAPK8/JNK, and the alternate pathways for CTL-mediated cytotoxicity. Accordingly, this protein is implicated in the pathogenesis of various malignancies and diseases of the immune system. The CD95/CD95L system was implicated in the etiology of inflammatory bowel disease (IBD) based, primarily, on the finding that CD95 is highly expressed in the intestinal epithelial cells and that epithelial apoptosis is increased in IBD.
References
  • Mschen M, et al. (2002) The origin of CD95-gene mutations in B-cell lymphoma. Trends Immunol. 23(2): 75-80.
  • Peter ME, et al. (2003) The CD95(APO-1/Fas) DISC and beyond. Cell Death Differ. 10(1): 26-35.
  • Peter ME, et al. (2005) Does CD95 have tumor promoting activities Biochim Biophys Acta. 1755(1): 25-36.
  • Chen L, et al. (2010) Cell death in the colonic epithelium during inflammatory bowel diseases: CD95/Fas and beyond. Inflamm Bowel Dis. 16(6): 1071-6.
  • TOP