Rat CD93/C1qR Gene ORF cDNA clone expression plasmid,N terminal Myc tag

Gene

Species

Rat

NCBI Ref Seq

NM_053383.1

RefSeq ORF Size

1932bp

Gene Synonym

Ly68, C1qRp, C1qr1, Cd93

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Rat CD93 molecule Gene ORF cDNA clone expression plasmid,N terminal Myc tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-N-Myc

Restriction Site

Protein Tag

Myc

Tag Sequence

GAGCAGAAACTCATCTCAGAAGAGGATCTG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

CD93 or C1q receptor 1 (C1qR) is an about 120 kDa O-sialoglycoprotein that within the hematopoietic system is selectively expressed on cells of the myeloid lineage. CD93/C1qR is a highly glycosylated transmembrane protein expressed on monocytes, neutrophils, endothelial cells, and stem cells. CD93 was originally identified as a myeloid cell-surface marker and subsequently associated with an ability to modulate phagocytosis of suboptimally opsonized immunoglobulin G and complement particles in vitro. CD93/C1qR, a receptor expressed during early B-cell development, is reinduced during plasma-cell differentiation. High CD93/CD138 expression was restricted to antibody-secreting cells both in T-dependent and T-independent responses as naive, memory, and germinal-center B cells remained CD93-negative. CD93 was expressed on (pre)plasmablasts/plasma cells, including long-lived plasma cells that showed decreased cell cycle activity, high levels of isotype-switched Ig secretion, and modification of the transcriptional network. CD93 is important for the maintenance of plasma cells in bone marrow niches.

References

Bohlson SS, et al. (2005) CD93 is rapidly shed from the surface of human myeloid cells and the soluble form is detected in human plasma. J Immunol. 175(2): 1239-47.

Norsworthy PJ, et al. (2004) Murine CD93 (C1qRp) contributes to the removal of apoptotic cells in vivo but is not required for C1q-mediated enhancement of phagocytosis. J Immunol. 172(6): 3406-14.

Chevrier S, et al. (2009) CD93 is required for maintenance of antibody secretion and persistence of plasma cells in the bone marrow niche. Proc Natl Acad Sci U S A. 106(10): 3895-900.

Catalog Number:RGB401-NM