Rat CD89/FCAR Gene ORF cDNA clone expression plasmid,C terminal OFP tag

Catalog Number:RGB396-CO

Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
843bp
Gene Synonym
CD89, Fcar
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Rat IgA Fc receptor Gene ORF cDNA clone expression plasmid,C terminal OFP tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-OFPSpark
Restriction Site
Protein Tag
OFPSpark
Tag Sequence
GATAGCACTGAG……CACCTGTTCCAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
OFPSpark Tag Information

OFPSpark is a red (orange) fluorescent protein (excitation/emission maxima are 549 and 566 nm, respectively) derived from DsRed. Possessing high photostability and pH stability, OFPSpark is more than twice brighter than mOrange2. Fast OFPSpark maturation makes it clearly detectable in mammalian cells as early as within 8 hrs after transfection. OFPSpark can be expressed and detected in a wide range of organisms. Mammalian cells transiently transfected with OFPSpark expression vectors produce bright fluorescence in 8 hrs after transfection. No cytotoxic effects or visible protein aggregation are observed. For its monomer structure, OFPSpark performs well in some fusions and protein labeling applications.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
FCAR, also called FcαRI or CD89, is a type I  transmembrane receptor for Fc region of IgA which is the most abundant immunoglobulin in mucosal areas but is only the second most common antibody isotype in serum. This receptor is present on the surface of myeloid lineage cells such as neutrophils, monocytes, macrophages, and eosinophils, especially phagocytes located in mucosal areas. Upon ligand IgA binding, FcαRI associates with the FcR γ signaling molecule bearing the immunoreceptor tyrosine-based activation motif (ITAM) through a unique charge-based mechanism and triggers multiple cell-mediated immune responses. It has been reported that Fc RI is a dual-function receptor that can mediate both inflammatory and anti-inflammatory responses depending on the type of interaction with its ligand. Sustained aggregation of FCAR results in activation of target-cell functions such as antigen presentation and cytokine release. In contrast, Monomeric targeting with serum IgA or with a variety of anti-FcαRI Fab fragments triggers an inhibitory response and additionally induces apoptosis. FcαRI thus play an fundamental role in preventing tumor development and growth, as well as in controlling inflammation.
References
  1. Maliszewski, C.R. et al., 1990, J. Exp. Med. 172: 1665-1672.
  2. Launay, P. et al., 1999, J. Biol. Chem. 274: 7216-7225.
  3. Monteiro, R.C. et al., 2003, Annu. Rev. Immunol. 21: 177-204.
  4. Otten, M.A. et al., 2005, J. Immunol. 174: 5472-5480.
  5. Pasquier, B. et al., 2005, Immunity. 22:31-42.
  6. Kanamaru, Y. et al., 2007, Blood. 109: 203-211.
TOP