Rat CD86/B7-2 Gene ORF cDNA clone expression plasmid,C terminal OFP tag

Catalog Number:RGB395-CO

Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
942bp
Gene Synonym
B7-2, Cd86
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Rat CD86 molecule Gene ORF cDNA clone expression plasmid,C terminal OFP tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-OFPSpark
Restriction Site
Protein Tag
OFPSpark
Tag Sequence
GATAGCACTGAG……CACCTGTTCCAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
OFPSpark Tag Information

OFPSpark is a red (orange) fluorescent protein (excitation/emission maxima are 549 and 566 nm, respectively) derived from DsRed. Possessing high photostability and pH stability, OFPSpark is more than twice brighter than mOrange2. Fast OFPSpark maturation makes it clearly detectable in mammalian cells as early as within 8 hrs after transfection. OFPSpark can be expressed and detected in a wide range of organisms. Mammalian cells transiently transfected with OFPSpark expression vectors produce bright fluorescence in 8 hrs after transfection. No cytotoxic effects or visible protein aggregation are observed. For its monomer structure, OFPSpark performs well in some fusions and protein labeling applications.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
CD86, also known as B-lymphocyte activation antigen B7-2 (referred to as B70), is a member of the cell surface immunoglobulin superfamily. B7-2 exists predominantly as a monomer on cell surfaces and interacts with two co-stimulatory receptors CD28 and cytotoxic T lymphocyte-associated antigen 4 (CTLA-4) expressed on T cells, and thus induces the signal pathways which regulate T cell activation and tolerance, cytokine production, and the generation of CTL. It is indicated that contacts between B and T helper cells mediated by CD86 encourage signals for the proliferation and IgG secretion of normal B cells and B cell lymphomas. Recent study has revealed that CD86 also promotes the generation of a mature APC repertoire and promotes APC function and survival. CD86 has an important role in chronic hemodialysis, allergic pulmonary inflammation, arthritis, and antiviral responses, and thus is regarded as a promising candidate for immune therapy.
References
  • Chen YQ, et al. (2006) CD28/CTLA-4--CD80/CD86 and ICOS--B7RP-1 costimulatory pathway in bronchial asthma. Allergy. 61(1): 15-26.
  • Rau FC, et al. (2009) B7-1/2 (CD80/CD86) direct signaling to B cells enhances IgG secretion. J Immunol. 183(12): 7661-71.
  • Dai ZS, et al. (2009) Defective expression and modulation of B7-2/CD86 on B cells in B cell chronic lymphocytic leukemia. Int J Hematol. 89(5): 656-63.
  • TOP