Rat CD80/B7-1 Gene ORF cDNA clone expression plasmid,N terminal Flag tag

Catalog Number:RGB389-NF

Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
966bp
Gene Synonym
B7-1, Cd80
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Rat Cd80 molecule Gene ORF cDNA clone expression plasmid,N terminal Flag tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-FLAG
Restriction Site
Protein Tag
Flag
Tag Sequence
GATTACAAGGATGACGACGATAAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Flag Tag Information

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
The B-lymphocyte activation antigen B7-1 (referred to as B7), also known as CD80, is a member of cell surface immunoglobulin superfamily and is expressed on the surface of antigen-presenting cells including activated B cells, macrophages and dendritic cells. As costimulatory ligands, B7-1 which exists predominantly as dimer and the related protein B7-2, interact with the costimulatory receptors CD28 and cytotoxic T lymphocyte-associated antigen 4 (CTLA-4) expressed on T cells, and thus constitute one of the dominant pathways that regulate T cell activation and tolerance, cytokine production, and the generation of CTL. The B7/CD28/CTLA4 pathway has the ability to both positively and negatively regulate immune responses. CD80 is thus regarded as promising therapeutic targets for autoimmune diseases and various carcinomas.
References
  • Greenfield EA, et al. (1998) CD28/B7 costimulation: a review. Crit Rev Immunol. 18(5): 389-418.
  • Zang X, et al. (2007) The B7 family and cancer therapy: costimulation and coinhibition. Clin Cancer Res. 13(18 Pt 1): 5271-9.
  • Mir MA, et al. (2008) Signaling through CD80: an approach for treating lymphomas. Expert Opin Ther Targets. 12(8): 969-79.
  • TOP