Rat CD300A Gene ORF cDNA clone expression plasmid,C terminal Myc tag

Catalog Number:RGB327-CM

Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
933bp
Gene Synonym
CLM-8, Cd300a
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Rat CD300A molecule Gene ORF cDNA clone expression plasmid,C terminal Myc tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-Myc
Restriction Site
Protein Tag
Myc
Tag Sequence
GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
CMRF35-like molecule 8, also known as CD300 antigen-like family member A, CMRF35-H9, Immunoglobulin superfamily member 12, Inhibitory receptor protein 60, NK inhibitory receptor, CD300a and CMRF35H, is a single-pass type I membrane protein which belongs to the CD300 family. The CD300 family of myeloid immunoglobulin receptors includes activating ( CD300b, CD300e ) and inhibitory members ( CD300a, CD300f ), as well as molecules presenting a negative charge within their transmembrane domain ( CD300c, CD300d ).  CD300A / IGSF12 is expressed not only by natural killer (NK) cells but also by T-cell subsets, B-cells, dendritic cells, mast cells, granulocytes and monocytes.It contains one Ig-like V-type ( immunoglobulin-like ) domain. CD300A / IGSF12 is an inhibitory receptor which may contribute to the down-regulation of cytolytic activity in natural killer (NK) cells, and to the down-regulation of mast cell degranulation. CD300c is a functional immune receptor able to deliver activating signals upon ligation in RBL-2H3 mast cells. CD300c signaling is partially mediated by a direct association with the immune receptor tyrosine-based activation motif-bearing adaptor FcεRγ. CD300a and CD300c play an important role in the cross-regulation of TNF-alpha and IFN-alpha secretion from plasmacytoid dendritic cells (pDCs).
References
  • Bachelet,I. et al., 2005, J. Immunol. 175:7989-7995.
  • Bachelet,I. et al., 2008, J Immunol. 180 (9):6064-9.
  • Ju,X. et al., 2008, Blood. 112 (4):1184-94.
  • Martínez-Barriocanal,A. et al., 2010, J Biol Chem. 285 (53):41781-94.
  • Lankry,D. et al., 2010, J Immunol. 185 (5):2877-86.
  • TOP