Rat CD219 / IL10RA Gene ORF cDNA clone expression plasmid,N terminal Flag tag

Catalog Number:RGB314-NF

Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
1710bp
Gene Synonym
Il10ra, IL-10ra
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Rat interleukin 10 receptor, alpha Gene ORF cDNA clone expression plasmid,N terminal Flag tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-FLAG
Restriction Site
Protein Tag
Flag
Tag Sequence
GATTACAAGGATGACGACGATAAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Flag Tag Information

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
CD210, also known as IL10RA, is a receptor for interleukin 10. CD210 has been shown to mediate the immunosuppressive signal of interleukin 10, and thus inhibits the synthesis of proinflammatory cytokines. It is structurally related to IFN receptors. It has been reported that CD210 promotes survival of progenitor myeloid cells. Activation of CD210 leads to tyrosine phosphorylation of JAK1 and TYK2 kinases.
References
  • Josephson K, et al. (2001) Purification, crystallization and preliminary X-ray diffraction of a complex between IL-10 and soluble IL-10R1. Acta Crystallogr D Biol Crystallogr. 57(Pt 12): 1908-11.
  • Tan, J C, et al. (1995) Characterization of recombinant extracellular domain of human interleukin-10 receptor. J Biol Chem. 270(21):12906-11.
  • Josephson, K, et al. (2001) Crystal structure of the IL-10/IL-10R1 complex reveals a shared receptor binding site. Immunity. 15(1):35-46.
  • TOP