Rat CD150 / SLAM / SLAMF1 Gene ORF cDNA clone expression plasmid,C terminal His tag

Catalog Number:RGB275-CH

Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
1038bp
Gene Synonym
RGD1560634, Slamf1
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Rat signaling lymphocytic activation molecule family member 1 Gene ORF cDNA clone expression plasmid,C terminal His tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-His
Restriction Site
Protein Tag
His
Tag Sequence
CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
His Tag Information

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
CD150/signaling lymphocytic activation molecule (SLAM) is a cell surface sialylated phosphoglycoprotein and belongs to the CD2 subset of the Ig superfamily of type I transmembrane glycoproteins. The CD150 receptor is expressed on thymocytes, activated and memory T cells, B cells, platelets, natural killer T cells, and mature dendritic cells, and is also detected on tumor cells of Hodgkin's lymphoma (HL) and diffuse large B-cell lymphoma with an activated B cell phenotype. Additionally, it is the immune cell receptor for measles virus (MV). As a self-ligand, CD150 performs diverse immunologic functions including T/B-cell costimulation, induction of IFN-&gamma in Th1 T-cell clones, redirection of Th2 clones to a Th1 or Th0 phenotype, and inhibition of apoptosis in B cells. Furthermore, CD150 was shown to be the second receptor for measles virus in addition to CD46, and the distribution of SLAM on various cell lines is consistent with their susceptibility to clinical isolates of measles virus.
References
  • Tatsuo H, et al. (2002) The morbillivirus receptor SLAM (CD150). Microbiol Immunol. 46(3): 135-42.
  • Sidorenko SP, et al. (2003)The dual-function CD150 receptor subfamily: the viral attraction. Nat Immunol. 4(1): 19-24.
  • Yurchenko MY, et al. (2010) CD150 regulates JNK1/2 activation in normal and Hodgkin's lymphoma B cells. Immunol Cell Biol. 88(5): 565-74.
  • Leonard VH, et al. (2010) Measles virus selectively blind to signaling lymphocytic activation molecule (SLAM ; CD150) is attenuated and induces strong adaptive immune responses in rhesus monkeys. J Virol. 84(7): 3413-20.
  • TOP