Rat CD122 / IL-2RB Gene ORF cDNA clone expression plasmid,C terminal Flag tag

Gene

Species

Rat

NCBI Ref Seq

NM_013195.1

RefSeq ORF Size

1614bp

Gene Synonym

IL2RBC, Il2rb

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Rat interleukin 2 receptor, beta Gene ORF cDNA clone expression plasmid,C terminal Flag tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-C-FLAG

Restriction Site

Protein Tag

Flag

Tag Sequence

GATTACAAGGATGACGACGATAAG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

Flag Tag Information

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

Interleukin-2 receptor (IL-2R) also known as High affinity IL-2 receptor subunit beta, IL-2 receptor subunit beta, and IL-2RB, is involved in T cell-mediated immune responses. CD122/IL-2RB is present in 3 forms with respect to ability to bind interleukin 2. The low affinity form is a monomer of the alpha subunit and is not involved in signal transduction. The intermediate affinity form consists of an alpha/beta subunit heterodimer, while the high affinity form consists of an alpha/beta/gamma subunit heterotrimer. Both the intermediate and high affinity forms of CD122/IL-2RB are involved in receptor-mediated endocytosis and transduction of mitogenic signals from interleukin 2. CD122/IL-2RB expression was restricted to the earliest B220+ cells (CD43+CD24-; prepro B cells; fraction A) that proliferate vigorously to IL-2 in the absence of any stromal cells, but not to IL-15. The high-affinity form of this receptor is expressed on activated T lymphocytes, activated B lymphocytes, and activated macrophages. CD122/IL-2RB plays a role in regulating normal lymphocyte development.

References

Foss F. (2006) Clinical experience with denileukin diftitox (ONTAK). Semin Oncol. 33(1 Suppl 3): 11-6.

Sprent J, et al. (2001) T cell death and memory. Science. 293(5528): 245-8.

Teshigawara K, et al. (1987) Interleukin 2 high-affinity receptor expression requires two distinct binding proteins. J Exp Med. 165 (1): 223-38.

Catalog Number:RGB265-CF