Rat CD111/Nectin-1/PVRL1 Gene ORF cDNA clone expression plasmid,without any tag

Catalog Number:RGB260-UT

Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
1548bp
Gene Synonym
HveC, nectin-1, Pvrl1
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Rat poliovirus receptor-related 1 Gene ORF cDNA clone expression plasmid,without any tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-untagged
Restriction Site
Protein Tag
Tag Sequence
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Poliovirus receptor-related 1 (herpesvirus entry mediator C; nectin-1; CD111), also known as PVRL1 is a cell adhesion molecule belonging to the immunoglobulin superfamily that can bind to virion glycoprotein D (gD) to mediate entry of herpes simplex viruses (HSV) and pseudorabies virus (PRV). CD111/Nectin-1/PVRL1 colocalizes with E-cadherin at adherens junctions in epithelial cells. The disruption of cell junctions can result in the redistribution of nectin-1. To determine whether disruption of junctions by calcium depletion influenced the susceptibility of epithelial cells to viral entry, Madin-Darby canine kidney cells expressing endogenous nectin-1 or transfected human nectin-1 were tested for the ability to bind soluble forms of viral gD and to be infected by HSV and PRV, before and after calcium depletion. It has been revealed that binding of HSV and PRV gD was localized to adherens junctions in cells maintained in normal medium but was distributed, along with nectin-1, over the entire cell surface after calcium depletion. Both the binding of gD and the fraction of cells that could be infected by HSV-1 and PRV were enhanced by calcium depletion. Taken together, CD111/Nectin-1/PVRL1 confined to adherens junctions in epithelial cells is not very accessible to virus, whereas dissociation of cell junctions releases nectin-1 to serve more efficiently as an entry recptor.
References
  • Yoon M, et al. (2002) Disruption of adherens junctions liberates nectin-1 to serve as receptor for herpes simplex virus and pseudorabies virus entry. J Virol. 76(14): 7203-8.
  • Mata M, et al. (2001) HveC (nectin-1) is expressed at high levels in sensory neurons, but not in motor neurons, of the rat peripheral nervous system. J Neurovirol. 7(5): 476-80.
  • Haarr L, et al. (2001) Transcription from the gene encoding the herpesvirus entry receptor nectin-1 (HveC) in nervous tissue of adult mouse. Virology. 287(2): 301-9.
  • TOP