Rat CCL6/C10 Gene ORF cDNA clone expression plasmid,C terminal Myc tag

Gene

Species

Rat

NCBI Ref Seq

BC079460.1

RefSeq ORF Size

348bp

Gene Synonym

Mrp-1, Scay6

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Rat chemokine (C-C motif) ligand 6 Gene ORF cDNA clone expression plasmid,C terminal Myc tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-C-Myc

Restriction Site

Protein Tag

Myc

Tag Sequence

GAGCAGAAACTCATCTCAGAAGAGGATCTG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

Chemokine (C-C motif) ligand 6 (CCL6), also known as C-C chemokine C10 has only been identified in rodents, which is a small cytokine belonging to the CC chemokine family, beta-chemokine subfamily. C-C chemokine C10 is involved in the chronic stages of host defense reactions. C10 chemokine rapidly promotes disease resolution in the cecal ligation and puncture (CLP) model through its direct effects on the cellular events critically involved in host defense during septic peritonitis. CCL6 appears to contribute to the macrophage infiltration that is independent of other CC chemokines. C10 is a prominent chemokine expressed in the central nervous system in experimental inflammatory demyelinating disease, also acts as a potent chemotactic factor for the migration of these leukocytes to the brain. CCL6 may be a mediator released by microglia for cell-cell communication under physiological as well as pathological conditions of CNS. Additionally, the chemokine CCL6 may alter tumor behavior by relieving its growth factor dependency and by promoting invasiveness as a result of local tissue apoptosis.

References

Asensio VC, et al. (1999) C10 is a novel chemokine expressed in experimental inflammatory demyelinating disorders that promotes recruitment of macrophages to the central nervous system. Am J Pathol. 154(4): 1181-91.

Steinhauser ML, et al. (2000) Chemokine C10 promotes disease resolution and survival in an experimental model of bacterial sepsis. Infect Immun. 68(11): 6108-14.

Yi F, et al. (2003) The CCL6 chemokine is differentially regulated by c-Myc and L-Myc, and promotes tumorigenesis and metastasis. Cancer Res. 63(11): 2923-32.

LaFleur AM, et al. (2004) Role of CC chemokine CCL6/C10 as a monocyte chemoattractant in a murine acute peritonitis. Mediators Inflamm. 13(5-6): 349-55.

Kanno M, et al. (2005) Functional expression of CCL6 by rat microglia: a possible role of CCL6 in cell-cell communication. J Neuroimmunol. 167(1-2): 72-80.

Catalog Number:RGB228-CM

CCL6/C10 related areas, pathways, and other information