Rat CCL20/MIP-3 alpha/MIP3A Gene ORF cDNA clone expression plasmid,C terminal OFP tag

Gene

Species

Rat

NCBI Ref Seq

NM_019233.1

RefSeq ORF Size

291bp

Gene Synonym

ST38, Scya20, Ccl20

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Rat chemokine (C-C motif) ligand 20 Gene ORF cDNA clone expression plasmid,C terminal OFP tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-C-OFPSpark

Restriction Site

Protein Tag

OFPSpark

Tag Sequence

GATAGCACTGAG……CACCTGTTCCAG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

OFPSpark Tag Information

OFPSpark is a red (orange) fluorescent protein (excitation/emission maxima are 549 and 566 nm, respectively) derived from DsRed. Possessing high photostability and pH stability, OFPSpark is more than twice brighter than mOrange2. Fast OFPSpark maturation makes it clearly detectable in mammalian cells as early as within 8 hrs after transfection. OFPSpark can be expressed and detected in a wide range of organisms. Mammalian cells transiently transfected with OFPSpark expression vectors produce bright fluorescence in 8 hrs after transfection. No cytotoxic effects or visible protein aggregation are observed. For its monomer structure, OFPSpark performs well in some fusions and protein labeling applications.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

Chemokine (C-C motif) ligand 20 (CCL20) or liver activation regulated chemokine (LARC) or Macrophage Inflammatory Protein-3 (MIP3A) is a small cytokine belonging to the CC chemokine family that attracts immature dendritic cells and memory T lymphocytes, both expressing CCR6. Depending on the cell type, this chemokine was found to be inducible by cytokines (IL-1beta) and by bacterial, viral, or plant products (including LPS, dsRNA, and PMA). MIP3A / CCL20 is Expressed predominantly in the liver, lymph nodes, appendix, peripheral blood lymphocytes, and fetal lung. Low levels of MIP3A / CCL20 has been seen in thymus, prostate, testis, small intestine and colon. As a chemotactic factor, MIP3A / CCL20 attracts lymphocytes and, slightly, neutrophils, but not monocytes. This chemokine may Inhibit proliferation of myeloid progenitors in colony formation assays and it may be involved in formation and function of the mucosal lymphoid tissues by attracting lymphocytes and dendritic cells towards epithelial cells. Its C-terminal processed forms have been shown to be equally chemotactically active for leukocytes. Chemokine CCL20 was shown to play a role in colorectal cancer (CRC) pathogenesis.

References

Vicinus B, et al. (2012) miR-21 functionally interacts with the 3'UTR of chemokine CCL20 and down-regulates CCL20 expression in miR-21 transfected colorectal cancer cells. Cancer Lett. 316(1): 105-12.

Ding X, et al. (2012) High Expression of CCL20 Is Associated with Poor Prognosis in Patients with Hepatocellular Carcinoma after Curative Resection. J Gastrointest Surg. 16(4): 828-36.

Ivison SM, et al. (2010) Oxidative stress enhances IL-8 and inhibits CCL20 production from intestinal epithelial cells in response to bacterial flagellin. Am J Physiol Gastrointest Liver Physiol. 299(3): 733-41.

Catalog Number:RGB215-CO