Rat Cathepsin D/CTSD Gene ORF cDNA clone expression plasmid,C terminal HA tag

Catalog Number:RGB140-CY

Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
1224bp
Gene Synonym
Ctsd
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Rat cathepsin D Gene ORF cDNA clone expression plasmid,C terminal HA tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-HA
Restriction Site
Protein Tag
HA
Tag Sequence
TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
HA Tag Information

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Cathepsin D (CTSD), a well known lysosomal aspartyl protease and belongs to the peptidase C1 family, which is a normal and major component of lysosomes, and is found in almost all cells and tissues of mammals. Its mostly described function is intracellular catabolism in lysosomal compartments, other physiological effect include hormone and antigen processing. Cathepsin D has a specificity similar to but narrower than that of pepsin A. Cathepsin D plays an important role in the degradation of proteins, the generation of bioactive proteins, antigen processing, etc. Among different role in cell physiology, a new function of this enzyme is examined. Cathepsin D is an important regulator of apoptotic pathways in cells. It acts at different stage of intrinsic and extrinsic pathway of apoptosis. In addition, CTSD secreted from human prostate carcinoma cells are responsible for the generation of angiostatin, a potent endogenous inhibitor of angiogenesis, suggesting its contribution to the prevention of tumor growth and angiogenesis-dependent growth of metastases.
References
  • Fusek M, et al. (2005) Dual role of cathepsin D: ligand and protease. Biomed Pap Med Fac Univ Palacky Olomouc Czech Repub. 149(1): 43-50.
  • Minarowska A, et al. (2007) Regulatory role of cathepsin D in apoptosis. Folia Histochem Cytobiol. 45(3): 159-63.
  • Zaidi N, et al. (2008) Cathepsin D: a cellular roadmap. Biochem Biophys Res Commun. 376(1): 5-9.
  • TOP