Rat Carboxypeptidase B2/CPB2 Gene ORF cDNA clone expression plasmid,N terminal HA tag

Catalog Number:RGB110-NY

Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
1269bp
Gene Synonym
Cpb2
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Rat carboxypeptidase B2 (plasma) Gene ORF cDNA clone expression plasmid,N terminal HA tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-HA
Restriction Site
Protein Tag
HA
Tag Sequence
TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
HA Tag Information

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Carboxypeptidase B2, also known as Carboxypeptidase U, Thrombin-activable fibrinolysis inhibitor, Plasma carboxypeptidase B, CPB2, is a secreted protein which belongs to the peptidase M14 family. Carboxypeptidases are enzymes that hydrolyze C-terminal peptide bonds. The carboxypeptidase family includes metallo-, serine, and cysteine carboxypeptidases. According to their substrate specificity, these enzymes are referred to as carboxypeptidase A (cleaving aliphatic residues) or carboxypeptidase B (cleaving basic amino residues). CPB2 is activated by thrombin and acts on carboxypeptidase B substrates. After thrombin activation, the mature protein downregulates fibrinolysis. CPB2 is synthesized by the liver and circulates in the plasma as a plasminogen-bound zymogen. When it is activated by proteolysis at residue Arg92 by the thrombin / thrombomodulin complex. CPB2 cleaves C-terminal arginine or lysine residues from biologically active peptides such as kinins or anaphylatoxins in the circulation thereby regulating their activities. CPB2 exhibits carboxypeptidase activity and activated CPB2 reduces fibrinolysis by removing the fibrin C-terminal residues that are important for the binding and activation of plasminogen.
References
  • Eaton DL. et al.,1991, J Biol Chem. 266 (32): 21833-8.
  • Boffa MB. et al.,1999, Biochemistry. 38 (20): 6547-58.
  • Liu T. et al., 2005, J. Proteome Res. 4: 2070-80.
  • Valnickova Z. et al., 2006, Biochemistry. 45: 1525-35.
  • Chen R. et al., 2009, J. Proteome Res. 8: 651-61.
  • TOP