Rat Carbonic Anhydrase XIII/CA13 Gene ORF cDNA clone expression plasmid,N terminal Myc tag

Catalog Number:RGB105-NM

Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
789bp
Gene Synonym
MGC189444, RGD1560453, Car13
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Rat carbonic anhydrase 13 Gene ORF cDNA clone expression plasmid,N terminal Myc tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-Myc
Restriction Site
Protein Tag
Myc
Tag Sequence
GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
The carbonic anhydrases (or carbonate dehydratases) are classified as metalloenzyme for its zinc ion prosthetic group and form a family of enzymes that catalyze the rapid interconversion of carbon dioxide and water to bicarbonate and protons, a reversible reaction that takes part in maintaining acid-base balance in blood and other tissues. The carbonic anhydrasekl (CA) family consists of at least 11 enzymatically active members and a few inactive homologous proteins. The CAXIII is a member of the CA family, which owns a globular molecule with high structural similarity to cytosolic isozymes, CAI, II, and III. Recombinant mouse CAXIII showed catalytic activity similar to those of mitochondrial CAV and cytosolic CAI. In human tissues, CAXIII expression was identified in the thymus, small intestine, spleen, prostate, ovary, colon, and testis. In mouse, positive tissues included the spleen, lung, kidney, heart, brain, skeletal muscle, and testis. In conclusion, the predicted amino acid sequence, structural model, distribution, and activity data suggest that CAXIII represents a novel enzyme, which may play important physiological roles in several organs.
References
  • Lehtonen J, et al. (2004) Characterization of CA XIII, a Novel Member of the Carbonic Anhydrase Isozyme Family. The Journal of Biological Chemistry. 279: 2719-27.
  • Lindskog S. (1997) Structure and mechanism of carbonic anhydrase. Pharmacology & Therapeutics. 74(1):1-20.
  • Lehtonen J, et al. (2004) Characterization of CA XIII, a Novel Member of the Carbonic Anhydrase Isozyme Family. The Journal of Biological Chemistry. 279: 2719-27.
  • TOP