Rat Calreticulin Gene ORF cDNA clone expression plasmid,C terminal OFP tag

Gene

Species

Rat

NCBI Ref Seq

NM_022399.2

RefSeq ORF Size

1251bp

Gene Synonym

Calr

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Rat calreticulin Gene ORF cDNA clone expression plasmid,C terminal OFP tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-C-OFPSpark

Restriction Site

Protein Tag

OFPSpark

Tag Sequence

GATAGCACTGAG……CACCTGTTCCAG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

OFPSpark Tag Information

OFPSpark is a red (orange) fluorescent protein (excitation/emission maxima are 549 and 566 nm, respectively) derived from DsRed. Possessing high photostability and pH stability, OFPSpark is more than twice brighter than mOrange2. Fast OFPSpark maturation makes it clearly detectable in mammalian cells as early as within 8 hrs after transfection. OFPSpark can be expressed and detected in a wide range of organisms. Mammalian cells transiently transfected with OFPSpark expression vectors produce bright fluorescence in 8 hrs after transfection. No cytotoxic effects or visible protein aggregation are observed. For its monomer structure, OFPSpark performs well in some fusions and protein labeling applications.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

Calreticulin is a multifunctional protein. It acts as a main Ca(2+)-binding (storage) protein in the lumen of the endoplasmic reticulum. Calreticulin binds Ca2+ ions (a second messenger in signal transduction), rendering it inactive. The Ca2+ is bound with low affinity, but high capacity, and can be released on a signal. Located in storage compartments associated with the endoplasmic reticulum, calreticulin also binds to misfolded proteins and prevents them from being exported from the endoplasmic reticulum to the golgi apparatus. The amino terminus of calreticulin interacts with the DNA-binding domain of the glucocorticoid receptor and prevents the receptor from binding to its specific glucocorticoid response element. Calreticulin reduces the binding of androgen receptor to its hormone-responsive DNA element and inhibits androgen receptor and retinoic acid receptor transcriptional activities in vivo, as well as retinoic acid-induced neuronal differentiation. Therefore, calreticulin acts as a significant modulator of the regulation of gene transcription by nuclear hormone receptors.

References

Michalak M, et al. (2002) Calreticulin in cardiac development and pathology. Biochim Biophys Acta. 1600(1-2):32-7.

Chao MP, et al. (2010) Calreticulin is the dominant pro-phagocytic signal on multiple human cancers and is counterbalanced by CD47. Sci Transl Med. 2(63):63ra94.

Andrin, C, et al. (1998) Interaction between a Ca2+-binding protein calreticulin and perforin, a component of the cytotoxic T-cell granules. Biochemistry. 37(29):10386-94.

Catalog Number:RGB066-CO