Rat CALML5 Gene ORF cDNA clone expression plasmid,N terminal HA tag

Gene

Species

Rat

NCBI Ref Seq

XM_001062982.2

RefSeq ORF Size

444bp

Gene Synonym

Calm4

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Rat calmodulin-like 5 Gene ORF cDNA clone expression plasmid,N terminal HA tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-N-HA

Restriction Site

Protein Tag

HA

Tag Sequence

TATCCTTACGACGTGCCTGACTACGCC

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

HA Tag Information

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

Calmodulin-like protein 5, also known as Calmodulin-like skin protein, CALML5 and CLSP, is a protein which contains four EF-hand domains. CALML5 / CLSP is particularly abundant in the epidermis where its expression is directly related to keratinocyte differentiation.The expression is very low in lung. CALML5 / CLSP binds calcium. It may be involved in terminal differentiation of keratinocytes. Coxsackievirus and adenovirus receptor (CAR) is a member of the immunoglobulin (Ig) superfamily and a component of epithelial tight junction. CAR functions as a primary receptor for coxsackievirus B and adenovirus (Ad) infection. CALML5 / CLSP is closely related to CAR. The structure and dynamics of human calmodulin-like skin protein CALML5 / CLSP have been characterized by NMR spectroscopy. The mobility of CALML5 / CLSP has been found to be different for the N-terminal and C-terminal domains. The N-terminal domain is characterized by four stable helices, which experience large fluctuations. This is shown to be due to mutations in the hydrophobic core. The overall N-terminal domain behavior is similar both in the full-length protein and in the isolated domain.

References

Mehul B., et al., 2000, J. Biol. Chem. 275:12841-12847.

Babini E., et al., 2006, Structure 14:1029-1038.

Kawabata,K. et al., 2007, Gene Ther. 14 (16):1199-207.

Catalog Number:RGB052-NY