Rat Cadherin-15/CDH15 Gene ORF cDNA clone expression plasmid,C terminal OFP tag

Gene

Species

Rat

NCBI Ref Seq

NM_207613.1

RefSeq ORF Size

2355bp

Gene Synonym

Cdh15

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Rat cadherin 15 Gene ORF cDNA clone expression plasmid,C terminal OFP tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-C-OFPSpark

Restriction Site

Protein Tag

OFPSpark

Tag Sequence

GATAGCACTGAG……CACCTGTTCCAG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

OFPSpark Tag Information

OFPSpark is a red (orange) fluorescent protein (excitation/emission maxima are 549 and 566 nm, respectively) derived from DsRed. Possessing high photostability and pH stability, OFPSpark is more than twice brighter than mOrange2. Fast OFPSpark maturation makes it clearly detectable in mammalian cells as early as within 8 hrs after transfection. OFPSpark can be expressed and detected in a wide range of organisms. Mammalian cells transiently transfected with OFPSpark expression vectors produce bright fluorescence in 8 hrs after transfection. No cytotoxic effects or visible protein aggregation are observed. For its monomer structure, OFPSpark performs well in some fusions and protein labeling applications.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

Cadherin-15, also known as CDH15, is a member of the cadherin superfamily. Cadherins consist of an extracellular domain containing 5 cadherin domains, a transmembrane region, and a conserved cytoplasmic domain. Cadherins are calcium dependent cell adhesion proteins. They preferentially interact with themselves in a homophilic manner in connecting cells; cadherins may thus contribute to the sorting of heterogeneous cell types. Cadherin-15 contains 5 cadherin domains. It is expressed in some normal epithelial tissues and in some carcinoma cell lines. Defects in CDH3 are the cause of ectodermal dysplasia with ectrodactyly and macular dystrophy (EEM), also known as EEM syndrome, Albrectsen-Svendsen syndrome or Ohdo-Hirayama-Terawaki syndrome. Ectodermal dysplasia defines a heterogeneous group of disorders due to abnormal development of two or more ectodermal structures. EEM is an autosomal recessive condition characterized by features of ectodermal dysplasia such as sparse eyebrows and scalp hair, and selective tooth agenesis associated with macular dystrophy and ectrodactyly.

References

Shibata T, et al. (1997) Identification of human cadherin-14, a novel neurally specific type II cadherin, by protein interaction cloning. J Biol Chem. 272(8):5236-40.

Bornemann A, et al. (1994) Immunocytochemistry of M-cadherin in mature and regenerating rat muscle. Anat Rec. 239(2):119-25.

Donalies M, et al. (1991) Expression of M-cadherin, a member of the cadherin multigene family, correlates with differentiation of skeletal muscle cells. Proc Natl Acad Sci. 88(18):8024-8.

Catalog Number:RGB037-CO