Rat BMP-7 Gene ORF cDNA clone expression plasmid,N terminal Myc tag

Gene

Species

Rat

NCBI Ref Seq

NM_001191856.1

RefSeq ORF Size

1293bp

Gene Synonym

BMP-7, Bmp7

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Rat bone morphogenetic protein 7 Gene ORF cDNA clone expression plasmid,N terminal Myc tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-N-Myc

Restriction Site

Protein Tag

Myc

Tag Sequence

GAGCAGAAACTCATCTCAGAAGAGGATCTG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

BMP-7 (Bone morphogenetic protein 7), also known as osteogenic protein 1 (OP-1), is a bone morphogenetic protein which belongs to the TGF-β superfamily. OP-1 is expressed in the brain, kidneys and bladder. BMP-7 may be involved in bone homeostasis. Osteogenic protein 1 plays a key role in the transformation of mesenchymal cells into bone and cartilage. The phosphorylation of SMAD1 and SMAD5 can be induced by BMP-7, which in turn induce transcription of numerous osteogenic genes. BMP-7 treatment can also induce all of the genetic markers of osteoblast differentiation in many cell types. The expression of BMP-7 causes ventral phenotypes while its complete inhibition creates a dorsal phenotype. Human recombinant BMP-7 protein can be used to aid in the fusion of vertebral bodies to prevent neurologic trauma. It also functions in the treatment of tibial non-union, frequently in cases where a bone graft has failed. It is found that BMP7 has the potential for treatment of chronic kidney disease.

References

Shi J. et al., 2010, Fertil Steril. 93(4): 1273-9.

González EA. et al., 2002, Kidney Int. 61(4): 1322-31.

Gould SE. et al., 2002, Kidney Int. 61(1): 51-60.

Hahn GV. et al., 1992, Genomics. 14(3): 759-62.

Catalog Number:RGA838-NM