Rat BMP-3b/GDF-10 Gene ORF cDNA clone expression plasmid,C terminal Myc tag

Catalog Number:RGA835-CM

Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
1431bp
Gene Synonym
Gdf10
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Rat growth differentiation factor 10 Gene ORF cDNA clone expression plasmid,C terminal Myc tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-Myc
Restriction Site
Protein Tag
Myc
Tag Sequence
GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
BMP-3b / GDF-10 is a member of the bone morphogenetic protein (BMP) family and the TGF-beta superfamily. This group of proteins is characterized by a polybasic proteolytic processing site which is cleaved to produce a mature protein containing seven conserved cysteine residues. The members of this family are regulators of cell growth and differentiation in both embryonic and adult tissues. Studies in mice suggest that the protein encoded by this gene plays a role in skeletal morphogenesis. In the bone morphogenetic cascade, cartilage differentiation, hypertrophy, and cell death are followed by bone formation. In this regard, all BMPs are cartilage morphogenetic proteins since cartilage is formed first. An overexpression or dysregulation of BMP pathways may lead to heterotopic bone formation or fibrodysplasia ossificans progressiva (FOP). BMPs have been implicated in FOP. The pioneering work of Sakou has implicated BMP-3b / GDF-10 in ossification of the posterior longitudinal ligament of the spine in Japanese patients. The BMP-specific antagonists such as noggin or chordin might be used therapeutically in clinical conditions with pathologically excessive bone formation. The osteoinductive capacity of BMPs has been demonstrated in preclinical models, and the efficacy of BMPs for the treatment of orthopaedic patients is now being evaluated in clinical trials. It was suggested that further progress in the clinical application of the BMP-3b / GDF-10 will depend upon the development of carriers with ideal release kinetics for the delivery of the BMPs.
References
  • Hino J, Takao M, Takeshita N, et al. (1996). "cDNA cloning and genomic structure of human bone morphogenetic protein-3B (BMP-3b).". Biochem. Biophys. Res. Commun. 223 (2): 304–10.
  • Kimura K, Toyooka S, Tsukuda K, et al. (2008). "The aberrant promoter methylation of BMP3b and BMP6 in malignant pleural mesotheliomas.". Oncol. Rep. 20 (5): 1265-8.
  • A. H. Reddi. (2001) Bone Morphogenetic Proteins: From Basic Science to Clinical Applications. Scientific Article. 83:1-6.
  • TOP