Rat BLMH/Bleomycin Hydrolase Gene ORF cDNA clone expression plasmid,N terminal Myc tag

Catalog Number:RGA823-NM

Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
1368bp
Gene Synonym
Blmh
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Rat bleomycin hydrolase Gene ORF cDNA clone expression plasmid,N terminal Myc tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-Myc
Restriction Site
Protein Tag
Myc
Tag Sequence
GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
The papain superfamily member bleomycin hydrolase (BLMH) is a cytoplasmic cysteine peptidase that is highly conserved through evolution. The only known activity of the enzyme is metabolic inactivation of the glycopeptide bleomycin (BLM), an essential component of combination chemotherapy regimens for cancer. The papain superfamily member bleomycin hydrolase (BLMH) is a neutral cysteine protease with structural similarity to a 20S proteasome. Bleomycin (BLM), a clinically used glycopeptide anticancer agent. BLMH is an essential protectant against BLM-induced death and has an important role in neonatal survival and in maintaining epidermal integrity. Sequencing revealed several putative sites phosphorylated by different types of protein kinases, but no signal sequence, transmembrane domain, N-linked glycosylation site or DNA-binding motif.
References
  • Takeda A, et al. (1996) Cloning and Analysis of cDNA Encoding Rat Bleomycin Hydrolase, a DNA-Binding Cysteine Protease. J Biochem. 120 (2): 353-9.
  • Lefterov IM, et al. (2000) Human bleomycin hydrolase regulates the secretion of amyloid precursor protein. The FASEB Journal. 14(12): 1837-47.
  • Brmme D, et al. (1996) Human Bleomycin Hydrolase: Molecular Cloning, Sequencing, Functional Expression, and Enzymatic Characterization. Biochemistry. 35 (21): 6706-14.
  • TOP