Rat BLBP/FABP7 Gene ORF cDNA clone expression plasmid,N terminal Myc tag

Catalog Number:RGA821-NM

Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
399bp
Gene Synonym
Fabp7
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Rat fatty acid binding protein 7, brain Gene ORF cDNA clone expression plasmid,N terminal Myc tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-Myc
Restriction Site
Protein Tag
Myc
Tag Sequence
GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
BLBP, also known as FABP7, is a brain fatty acid binding protein. Fatty acid binding proteins (FABPs) are a family of small, highly conserved, cytoplasmic proteins that bind long-chain fatty acids and other hydrophobic ligands. FABP7 binds DHA with the highest affinity among all of the FABPs. FABPs may play roles in fatty acid uptake, transport, and metabolism. BLBP is expressed, during development, in radial glia by the activation of notch receptors. It was shown that reelin induces FABP7 expression in neural progenitor cells via notch-1 activation. BLBP variation is linked to weak prepulse inhibition(PPI) in mice and deficit in PPI is an endophenotypic trait observed in schizophrenia patients and their relatives.
References
  • Shi YE, et al. (1997) Antitumor activity of the novel human breast cancer growth inhibitor, mammary-derived growth inhibitor-related gene, MRG. Cancer Res. 57(15):3084-91.
  • Young JK, et al. (1997) Immunoreactivity for brain-fatty acid binding protein in gomori-positive astrocytes. Glia. 16(3):218-26.
  • Xu LZ, et al. (1996) Ligand specificity of brain lipid-binding protein. J Biol Chem. 271(40): 24711-9.
  • TOP