Rat Beta-2 microglobulin/B2M Gene ORF cDNA clone expression plasmid,N terminal OFP tag

Catalog Number:RGA798-NO

Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
360bp
Gene Synonym
B2m
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Rat beta-2 microglobulin Gene ORF cDNA clone expression plasmid,N terminal OFP tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-OFPSpark
Restriction Site
Protein Tag
OFPSpark
Tag Sequence
GATAGCACTGAG……CACCTGTTCCAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
OFPSpark Tag Information

OFPSpark is a red (orange) fluorescent protein (excitation/emission maxima are 549 and 566 nm, respectively) derived from DsRed. Possessing high photostability and pH stability, OFPSpark is more than twice brighter than mOrange2. Fast OFPSpark maturation makes it clearly detectable in mammalian cells as early as within 8 hrs after transfection. OFPSpark can be expressed and detected in a wide range of organisms. Mammalian cells transiently transfected with OFPSpark expression vectors produce bright fluorescence in 8 hrs after transfection. No cytotoxic effects or visible protein aggregation are observed. For its monomer structure, OFPSpark performs well in some fusions and protein labeling applications.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
B2M, also known as β2-Microglobulin or CDABP0092, is a component of MHC class I molecules found expression in all nucleated cells (excludes red blood cells). The major function of MHC class I moleculesis is to display fragments of proteins from within the cell to T-cells and cells containing foreign proteins will be attacked. B2M(β2-Microglobulin) is a low molecular weight protein. It was demonstrated that B2M(β2-Microglobulin) was localized in the membranes of nucleated cells and was found to be associated with HL-A antigens.B2M(β2- Microglobulin) is present in free form in various body fluids and as a subunit of histocompatibility antigens on cell surfaces lateral to theα3 chain. Unlikeα3, β2 has no transmembrane region. Directly above β2 lies the α1 chain, which itself is lateral to the α2. In the absence of B2M(β2 microglobulin), very limited amounts of MHC class I (classical and non-classical) molecules can be detected on the surface. In the absence of MHC class I, CD8 T cells, a subset of T cells involved in the development of acquired immunity cannot develop. Low levels of B2M(β2 microglobulin) can indicate non-progression of HIV.
References
  • Poulik MD, et al. (1979) Beta 2-Microglobulin: methods and clinical applications. CRC Ctit Rev Clin Lab Sci. 10(3): 225-45.
  • Poulik MD, et al. (1975) Beta2-Microglobulins. Contemp Top Mol Immunol. 4: 157-204.
  • Berggard I. (1976) Beta2-Microglobulins: isolation, properties, and distribution. Fed Proc. 35(5): 1167-70.
  • TOP