Rat ASAM / CLMP Gene ORF cDNA clone expression plasmid,N terminal Flag tag

Catalog Number:RGA582-NF

Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
1119bp
Gene Synonym
ACAM, CLMP, Ol16, Asam
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Rat adipocyte-specific adhesion molecule Gene ORF cDNA clone expression plasmid,N terminal Flag tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-FLAG
Restriction Site
Protein Tag
Flag
Tag Sequence
GATTACAAGGATGACGACGATAAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Flag Tag Information

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Adipocyte-specific adhesion molecule (ASAM), also known as ACAM and CLMP, is a type I transmembrane protein and a member of the CTX (cortical thymocyte marker in Xenopus) family within the immunoglobulin superfamily. ASAM protein is highly expressed in the small intestine and placenta, and is found at intermediate levels in the heart, skeletal muscle, colon, spleen, kidney, and lung, and appears in low levels in the liver and peripheral blood leukocytes as well. ASAM is a transmembrane component of tight junctions in epithelial cells that can mediate cell aggregation and regulate transepithelial resistance across polarized epithelial cells. In addition, its expression is strongly correlated with white adipose tissue (WAT) mass of human and rodents with obesity.
References
  • Eguchi J, et al. (2005) Identification of adipocyte adhesion molecule (ACAM), a novel CTX gene family, implicated in adipocyte maturation and development of obesity. Biochem J. 387(Pt 2): 343-53.
  • Sze KL, et al. (2008) Expression of CLMP, a novel tight junction protein, is mediated via the interaction of GATA with the Kruppel family proteins, KLF4 and Sp1, in mouse TM4 Sertoli cells. J Cell Physiol. 214(2): 334-44.
  • Sze KL, et al. (2008) Post-transcriptional regulation of CLMP mRNA is controlled by tristetraprolin in response to TNFalpha via c-Jun N-terminal kinase signalling. Biochem J. 410(3): 575-83.
  • TOP