Rat ARG1/Arginase 1 Gene ORF cDNA clone expression plasmid,C terminal OFP tag

Catalog Number:RGA517-CO

Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
972bp
Gene Synonym
Arg1
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Rat arginase 1 Gene ORF cDNA clone expression plasmid,C terminal OFP tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-OFPSpark
Restriction Site
Protein Tag
OFPSpark
Tag Sequence
GATAGCACTGAG……CACCTGTTCCAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
OFPSpark Tag Information

OFPSpark is a red (orange) fluorescent protein (excitation/emission maxima are 549 and 566 nm, respectively) derived from DsRed. Possessing high photostability and pH stability, OFPSpark is more than twice brighter than mOrange2. Fast OFPSpark maturation makes it clearly detectable in mammalian cells as early as within 8 hrs after transfection. OFPSpark can be expressed and detected in a wide range of organisms. Mammalian cells transiently transfected with OFPSpark expression vectors produce bright fluorescence in 8 hrs after transfection. No cytotoxic effects or visible protein aggregation are observed. For its monomer structure, OFPSpark performs well in some fusions and protein labeling applications.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Arginase is the focal enzyme of the urea cycle hydrolysing L-arginine to urea and L-ornithine. Emerging studies have identified arginase in the vasculature and have implicated this enzyme in the regulation of nitric oxide (NO) synthesis and the development of vascular disease. Arginase also redirects the metabolism of L-arginine to L-ornithine and the formation of polyamines and L-proline, which are essential for smooth muscle cell growth and collagen synthesis. Arginase is encoded by two recently discovered genes (Arginase I and Arginase II). In most mammals, Arginase 1 (ARG1) also known as Arginase, liver, which functions in the urea cycle, and is located primarily in the cytoplasm of the liver. The second isozyme, Arginase II, has been implicated in the regulation of the arginine/ornithine concentrations in the cell. It is located in mitochondria of several tissues in the body, with most abundance in the kidney and prostate. It may be found at lower levels in macrophages, lactating mammary glands, and brain.
References
  • Durante W, et al. (2007) Arginase: a critical regulator of nitric oxide synthesis and vascular function. Clin Exp Pharmacol Physiol. 34(9): 906-11.
  • Waddington SN. (2002) Arginase in glomerulonephritis. Kidney Int. 61(3): 876-81.
  • Morris SM. (2002). Regulation of enzymes of the urea cycle and arginine metabolism. Annual review of nutrition. 22 (1): 87-105.
  • TOP