Rat Antithrombin III/ATIII Gene ORF cDNA clone expression plasmid,N terminal Myc tag

Gene

Species

Rat

NCBI Ref Seq

NM_001012027.1

RefSeq ORF Size

1398bp

Gene Synonym

Serpinc1

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Rat serpin peptidase inhibitor, clade C (antithrombin), member 1 Gene ORF cDNA clone expression plasmid,N terminal Myc tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-N-Myc

Restriction Site

Protein Tag

Myc

Tag Sequence

GAGCAGAAACTCATCTCAGAAGAGGATCTG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

SerpinC1, also known as antithrombin III (AT III), is a member of the serpin superfamily of serine protease inhibitors, and has been found to be a marker for disseminated intravascular coagulation (DIC) and to be of prognostic significance in septic patients. SerpinC1 synthesized in the liver is the principal plasma serpin of blood coagulation proteases and inhibits thrombin and other factors such as Xa by the formation of covalently linked complexes. Thus it is one of the most important coagulation inhibitors and the fundamental enzyme for the therapeutical action of heparin. In common with SerpinA5 and D1, the inhibitory activity of SerpinC1 undergoes a dramatic increase in the presence of heparin and other glycosaminoglycans. ATIII mediates the promotion of prostaglandin release, an inhibitor of leucocyte activation and downregulator of many proinflammatory cytokines. Antithrombin III exerts anti-inflammatory properties in addition to its anti-coagulative mechanisms. In animal models of sepsis, ATIII affected cytokine plasma concentrations with a decrease of pro-inflammatory cytokines. The deficiency or functional abnormality of ATIII may result in an increased risk of thromboembolic disease, such as deep vein thrombosis and pulmonary embolism. In addition, it has been reported that SerpinC1 can alter or influence inflammatory processes via inhibition of NF-κB activation or actin polymerization.

References

de Sousa JC, et al. (1991) Antithrombin III. Physiologic, physiopathologic and laboratory aspects. Rev Port Cardiol. 10(9): 693-9.

Totzke G, et al. (2001) Antithrombin III enhances inducible nitric oxide synthase gene expression in vascular smooth muscle cells. Cell Immunol. 208(1): 1-8.

Ostermann H. (2002) Antithrombin III in Sepsis. New evidences and open questions. Minerva Anestesiol. 68(5): 445-8.

Caglikulekci M, et al. (2004) Effect of antithrombin-III (AT-III) on intestinal epithelium changes related to obstructive icterus: experimental study in rats. Ann Chir. 129(5): 273-7.

Catalog Number:RGA429-NM