Rat ALK-6 / BMPR1B Gene ORF cDNA clone expression plasmid,N terminal Myc tag

Catalog Number:RGA347-NM

Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
894bp
Gene Synonym
CFK-43a, Bmpr1b
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Rat bone morphogenetic protein receptor, type IB Gene ORF cDNA clone expression plasmid,N terminal Myc tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-Myc
Restriction Site
Protein Tag
Myc
Tag Sequence
GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
BMPR1B(bone morphogenetic protein receptor, type IB), also known as ALK6, is a a member of the bone morphogenetic protein (BMP) receptor family. BMPs are involved in endochondral bone formation and embryogenesis. These proteins transduce their signals through the formation of heteromeric complexes of 2 different types of serine (threonine) kinase receptors: type I receptors of about 50-55 kD and type II receptors of about 70-80 kD. Type II receptors bind ligands in the absence of type I receptors, but they require their respective type I receptors for signaling, whereas type I receptors require their respective type II receptors for ligand binding. BMPR1B is the major transducer of signals in precartilaginous condensations as demonstrated in experiments using constitutively active BMPR1B receptors. BMPR1B is a more effective trasducer of GDF5 than BMPR1A. Unlike BMPR1A null mice, which die at an early embryonic stage, BMPR1B null mice are viable.
References
  • Ide H, et al. (1998) Assignment of the BMPR1A and BMPR1B genes to human chromosome 10q22.3 and 4q23--q24 byin situ hybridization and radiation hybrid map ping. Cytogenet. Cell Genet. 81(3-4): 285-6.
  • Mishina Y, et al. (2004) Bone morphogenetic protein type IA receptor signaling regulates postnatal osteoblast function and bone remodeling. J Biol Chem. 279(26): 27560-6.
  • Yoon BS, et al. (2005) Bmpr1a and Bmpr1b have overlapping functions and are essential for chondrogenesis in vivo. Proc Natl Acad Sci. 102(14): 5062-7.
  • TOP