Rat ALK-2/ACVR1 Gene ORF cDNA clone expression plasmid,C terminal OFP tag

Gene

Species

Rat

NCBI Ref Seq

NM_024486.1

RefSeq ORF Size

1530bp

Gene Synonym

Acvr1

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Rat activin A receptor, type I Gene ORF cDNA clone expression plasmid,C terminal OFP tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-C-OFPSpark

Restriction Site

Protein Tag

OFPSpark

Tag Sequence

GATAGCACTGAG……CACCTGTTCCAG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

OFPSpark Tag Information

OFPSpark is a red (orange) fluorescent protein (excitation/emission maxima are 549 and 566 nm, respectively) derived from DsRed. Possessing high photostability and pH stability, OFPSpark is more than twice brighter than mOrange2. Fast OFPSpark maturation makes it clearly detectable in mammalian cells as early as within 8 hrs after transfection. OFPSpark can be expressed and detected in a wide range of organisms. Mammalian cells transiently transfected with OFPSpark expression vectors produce bright fluorescence in 8 hrs after transfection. No cytotoxic effects or visible protein aggregation are observed. For its monomer structure, OFPSpark performs well in some fusions and protein labeling applications.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

ALK-2, also termed as ACVR1, was initially identified as an activin type I receptor because of its ability to bind activin in concert with ActRII or ActRIIB. ALK-2 is also identified as a BMP type I receptor. It has been demonstrated that ALK-2 forms complex with either the BMP-2/7-bound BMPR-II or ACVR2A /ACVR2B. ALK-1 and ALK-2 presenting in the yeast Saccharomyces cerevisiae are two haspin homologues. Both ALK-1 and ALK-2 exhibit a weak auto-kinase activity in vitro, and are phosphoproteins in vivo. ALK-1 and ALK-2 levels peak in mitosis and late-S/G2. Control of protein stability plays a major role in ALK-2 regulation. The half-life of ALK-2 is particularly short in G1. Overexpression of ALK-2, but not of ALK-1, causes a mitotic arrest, which is correlated to the kinase activity of the protein. This suggests a role for ALK-2 in the control of mitosis. Endoglin is phosphorylated on cytosolic domain threonine residues by the TGF-beta type I receptors ALK-2 and ALK-5 in prostate cancer cells. Endoglin did not inhibit cell migration in the presence of constitutively active ALK-2. Defects in ALK-2 are a cause of fibrodysplasia ossificans progressiva (FOP).

References

Armes NA,et al. (1997) The ALK-2 and ALK-4 activin receptors transduce distinct mesoderm-inducing signals during early Xenopus development but do not co-operate to establish thresholds. Development 124(19): 3797-804.

Armes NA, et al. (1999) A short loop on the ALK-2 and ALK-4 activin receptors regulates signaling specificity but cannot account for all their effects on early Xenopus development. J Biol Chem. 274(12):7929-35.

Kawai S, et al. (2000) Mouse smad8 phosphorylation downstream of BMP receptors ALK-2, ALK-3, and ALK-6 induces its association with Smad4 and transcriptional activity.Biochem Biophys Res Commun. 271(3):682-7.

Deng Y, et al. (2009) Efficient highly selective synthesis of methyl 2-(ethynyl)alk-2(E)-enoates and 2-(1'-chlorovinyl)alk-2(Z)-enoates from 2-(methoxycarbonyl)-2,3-allenols. Organic letters 11(10):2169-72.

Catalog Number:RGA343-CO