Rat ALK-1/ACVRL1 Gene ORF cDNA clone expression plasmid,C terminal HA tag

Catalog Number:RGA341-CY

Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
1515bp
Gene Synonym
R3, R-3, SETHKIR, MGC91691, Acvrl1
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Rat activin A receptor type II-like 1 Gene ORF cDNA clone expression plasmid,C terminal HA tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-HA
Restriction Site
Protein Tag
HA
Tag Sequence
TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
HA Tag Information

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Activin A receptor, type II-like 1 (ACVRL1), also known as ALK-1 (activin receptor-like kinase 1), is an endothelial-specific type I receptor of the TGF-beta (transforming growth factor beta) receptor family of ligands. On ligand binding, a heteromeric receptor complex forms consisting of two type II and two type I transmembrane serine/threonine kinases. ACVRL1 protein is expressed in certain blood vessels of kidney, spleen, heart and intestine, serving as an important role during vascular development. Mutations in ACVRL1 gene are associated with hemorrhagic telangiectasia type 2, also known as Rendu-Osler-Weber syndrome 2 and vascular disease.
References
  • French Rendu-Osler network,et al. (2004) Molecular screening of ALK1/ACVRL1 and ENG genes in hereditary hemorrhagic telangiectasia in France. Hum Mutat. 23(4): 289-299.
  • Simon M, et al. (2006) Association of a polymorphism of the ACVRL1 gene with sporadic arteriovenous malformations of the central nervous system. J Neurosurg. 104(6): 945-9.
  • Argyriou L, et al. (2006) Novel mutations in the ENG and ACVRL1 genes causing hereditary hemorrhagic teleangiectasia. Int J Mol Med. 17(4):655-9.
  • TOP