Rat AKR1A1 Gene ORF cDNA clone expression plasmid,N terminal Myc tag

Catalog Number:RGA288-NM

Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
978bp
Gene Synonym
Akr1a4
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Rat aldo-keto reductase family 1, member A1 (aldehyde reductase) Gene ORF cDNA clone expression plasmid,N terminal Myc tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-Myc
Restriction Site
Protein Tag
Myc
Tag Sequence
GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Aldehyde reductase (AKR1A1) is a member of the aldo-keto reductase superfamily, which consists of more than 40 known enzymes and proteins that includes variety of monomeric NADPH-dependent oxidoreductases, such as aldehyde reductase. Aldehyde reductase has wide substrate specificities for carbonyl compounds. These enzymes are implicated in the development of diabetic complications by catalyzing the reduction of glucose to sorbitol. Aldehyde reductase possess a structure with a beta-alpha-beta fold which contains a novel NADP-binding motif. The binding site is located in a large, deep, elliptical pocket in the C-terminal end of the beta sheet, the substrate being bound in an extended conformation. This binding is more similar to FAD- than to NAD(P)-binding oxidoreductases. AKR1A1 is involved in the reduction of biogenic and xenobiotic aldehydes and is present in virtually every tissue.
References
  • Bohren KM, et al. (1989) The aldo-keto reductase superfamily. cDNAs and deduced amino acid sequences of human aldehyde and aldose reductases. J Biol Chem. 264 (16): 9547-51.
  • Fujii J, et al. (1999) The structural organization of the human aldehyde reductase gene, AKR1A1, and mapping to chromosome. Cytogenetics and Cell Genetics . 84 (3-4): 33-2.
  • TOP