Rat 14-3-3 sigma/Stratifin/YWHAS Gene ORF cDNA clone expression plasmid,N terminal Flag tag

Catalog Number:RGA016-NF

Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
747bp
Gene Synonym
Sfn
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Rat stratifin Gene ORF cDNA clone expression plasmid,N terminal Flag tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-FLAG
Restriction Site
Protein Tag
Flag
Tag Sequence
GATTACAAGGATGACGACGATAAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Flag Tag Information

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
14-3-3 protein sigma (YWHAS), also known as stratifin (SFN) and epithelial cell marker protein 1, is a member of the14-3-3 proteins which are a family of conserved regulatory molecules expressed in all eukaryotic cells. The name 14-3-3 refers to the particular elution and migration pattern of these proteins on DEAE-cellulose chromatography and starch-gel electrophoresis. The 14-3-3 proteins eluted in the 14th fraction of bovine brain homogenate and were found on positions 3.3 of subsequent electrophoresis. There are seven genes that encode 14-3-3s in most mammals. 14-3-3 proteins have been identified as adapter proteins implicated in the regulation of a large spectrum of both general and specialized signaling pathway. More than 100 signaling proteins have been reported as 14-3-3 ligands including kinases, phosphatases, and transmembrane receptors, and the binding generally results in the modulation of the activity of the binding partner. YWHAE exists as a homodimer and present mainly in tissues enriched in stratified squamous keratinising epithelium. YWHAS has been repoted to interact with KRT17 and GAB2, and may regulate protein synthesis and epithelial cell growth by stimulating Akt/mTOR pathway upon binding to KRT17. Additionally, YWHAS (SFN) may also act as a p53-regulated inhibitor of G2/M progression.
References
TOP