Canine XCL1 Gene ORF cDNA clone expression plasmid,C terminal Flag tag

Gene

Species

Canine

NCBI Ref Seq

XM_547477.2

RefSeq ORF Size

339bp

Gene Synonym

XCL2, XCL1

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Canine chemokine (C motif) ligand 1 Gene ORF cDNA clone expression plasmid,C terminal Flag tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-C-FLAG

Restriction Site

Protein Tag

Flag

Tag Sequence

GATTACAAGGATGACGACGATAAG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

Flag Tag Information

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

This antimicrobial gene encodes a member of the chemokine superfamily. Chemokines function in inflammatory and immunological responses, inducing leukocyte migration and activation. The encoded protein is a member of the C-chemokine subfamily, retaining only two of four cysteines conserved in other chemokines, and is thought to be specifically chemotactic for T cells. This gene and a closely related family member are located on the long arm of chromosome 1.

References

Nguyen KD, et al. (2008) XCL1 enhances regulatory activities of CD4⁺ CD25(high) CD127(low/-) T cells in human allergic asthma. J Immunol. 181 (8): 5386-95.

Dong C, et al. (2005) Glycosylated recombinant human XCL1 / lymphotactin exhibits enhanced biologic activity. J Immunol Methods. 302 (1-2): 136-44.

Zavala-Flores LM, et al. (2009) Production of biologically active human lymphotactin (XCL1) by Lactococcus lactis. Biotechnol Lett. 31 (2): 215-20.

Guzzo C, Fox JC, Miao H, Volkman BF, Lusso P. Structural Determinants for the Selective Anti-HIV-1 Activity of the All-β Alternative Conformer of XCL1. Kirchhoff F, ed. Journal of Virology. 2015;89(17):9061-9067.

Catalog Number:MGI476-CF