Mouse WWP2 Gene ORF cDNA clone expression plasmid,C terminal HA tag

Catalog Number:MGI473-CY

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
2613bp
Gene Synonym
AIP2, AA690238, AW554328, 1300010O06Rik
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Mouse WW domain containing E3 ubiquitin protein ligase 2 Gene ORF cDNA clone expression plasmid,C terminal HA tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-HA
Restriction Site
Protein Tag
HA
Tag Sequence
TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
HA Tag Information

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
WWP2 contains 1 C2 domain, 1 HECT (E6AP-type E3 ubiquitin-protein ligase) domain and 4 WW domains. It is an E3 ubiquitin-protein ligase which accepts ubiquitin from an E2 ubiquitin-conjugating enzyme in the form of a thioester and then directly transfers the ubiquitin to targeted substrates. WWP2 can be detected in heart, throughout the brain, placenta, lung, liver, muscle, kidney and pancreas. It is also expressed in spleen and peripheral blood leukocytes. WWP2 polyubiquitinates POU5F1 by 'Lys-63'-linked conjugation and promotes it to proteasomal degradation; in embryonic stem cells (ESCs) the ubiquitination is proposed to regulate POU5F1 protein level. WWP2 ubiquitinates EGR2 and promotes it to proteasomal degradation; in T-cells the ubiquitination inhibits activation-induced cell death. It also ubiquitinates SLC11A2; the ubiquitination is enhanced by presence of NDFIP1 and NDFIP2. WWP2 ubiquitinates RPB1 and promotes it to proteasomal degradation.
References
  • McDonald FJ, et al. (2002) Ubiquitin-protein ligase WWP2 binds to and downregulates the epithelial Na(+) channel. Am J Physiol Renal Physiol. 283 (3): F431-6.
  • Soond SM, et al. (2011) Selective targeting of activating and inhibitory Smads by distinct WWP2 ubiquitin ligase isoforms differentially modulates TGFβ signalling and EMT. Oncogene. 30 (21): 2451-62.
  • Marcucci R, et al. (2011) Pin1 and WWP2 regulate GluR2 Q/R site RNA editing by ADAR2 with opposing effects. EMBO J. 30 (20): 4211-22.
  • Maddika S, et al. (2011) WWP2 is an E3 ubiquitin ligase for PTEN. Nat Cell Biol. 13 (6): 728-33.
  • Xu H, et al. (2009) WWP2 promotes degradation of transcription factor OCT4 in human embryonic stem cells. Cell Res. 19 (5): 561-73.
  • TOP