Mouse VSIG4 Gene ORF cDNA clone expression plasmid,N terminal OFP tag

Catalog Number:MGI393-NO

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
843bp
Gene Synonym
CRIg, Z39IG, BC025105, MGC36211, A530061A11, Vsig4
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Mouse V-set and immunoglobulin domain containing 4 Gene ORF cDNA clone expression plasmid,N terminal OFP tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-OFPSpark
Restriction Site
Protein Tag
OFPSpark
Tag Sequence
GATAGCACTGAG……CACCTGTTCCAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
OFPSpark Tag Information

OFPSpark is a red (orange) fluorescent protein (excitation/emission maxima are 549 and 566 nm, respectively) derived from DsRed. Possessing high photostability and pH stability, OFPSpark is more than twice brighter than mOrange2. Fast OFPSpark maturation makes it clearly detectable in mammalian cells as early as within 8 hrs after transfection. OFPSpark can be expressed and detected in a wide range of organisms. Mammalian cells transiently transfected with OFPSpark expression vectors produce bright fluorescence in 8 hrs after transfection. No cytotoxic effects or visible protein aggregation are observed. For its monomer structure, OFPSpark performs well in some fusions and protein labeling applications.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
VSIG4 (V-set and immunoglobulin domain containing 4), also known as complement receptor of the immunoglobulin superfamily (CRIg) and Z39Ig, is a type I  transmembrane glycoprotein. It is a B7 family-related protein and an Ig superfamily member. In contrast to the B7 family members which contain two IgG domains, VSIG4 contains one complete V-type I g domain and a truncated C-type I g domain. VSIG4 is exclusively expressed on tissue resident macrophages and binds to multimers of C3b and iC3b that are covalently attached to particle surfaces. No VSIG4 expression appears to be present in T and B cells. VSIG4 functions as a negative regulator of T cell activation, and may be involved in the maintenance of peripheral T cell tolerance, and is also identified as a potent suppressor of established inflammation. Mouse VSIG4 is synthesized as a 280 amino acid precursor that contains a signal sequence, an V-type I g domain (aa 36-115), one potential N-linked glycosylation site, and a single transmembrane domain. The V-type I g domain of mouse VSIG4 shares 86% and 80% aa sequence identity with the V-type I g domains of rat and human VSIG4, respectively.
References
  • Vogt, L. et al., 2006, J Clin Invest.116: 2817-2826.
  • Helmy, K. et al., 2006, Cell. 124:915-927.
  • Wiesmann, C. et al., 2006, Nature. 444:217-220.
  • Zang,X. et al., 2006, J Clin Invest. 116: 2590-2593.
  • Katschke, KJ. et al., 2007, J. Exp. Med. 204:1319-1325.
  • He,JQ. et al., 2008, Mol Immunol. 45: 4041-4047.
  • TOP