Mouse VE-statin/EGFL7 Gene ORF cDNA clone expression plasmid,C terminal Flag tag

Catalog Number:MGI341-CF

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
825bp
Gene Synonym
Zneu1, VE-statin, Egfl7
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Mouse EGF-like domain 7 Gene ORF cDNA clone expression plasmid,C terminal Flag tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-FLAG
Restriction Site
KpnI + XbaI (6kb + 0.86kb)
Protein Tag
Flag
Tag Sequence
GATTACAAGGATGACGACGATAAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Flag Tag Information

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Epidermal growth factor-like protein 7, also known as EGF-like protein 7, Multiple epidermal growth factor-like domains protein 7, Multiple EGF-like domains protein 7, Vascular endothelial statin, NOTCH4-like protein and EGFL7, is a secreted protein which contains two EGF-like domains and one EMI domain. EGFL7 was identified by a number of groups as a putative secreted factor produced by the vascular endothelial cells (ECs). EGFL7 is described as a novel endothelial cell-derived factor involved in the regulation of the spatial arrangement of cells during vascular tube assembly. With its impact on tubulogenesis and vessel shape EGFL7 joined the large family of molecules governing blood vessel formation. EGFL7 regulates midline angioblast migration in zebrafish embryos-a key step in vascular tubulogenesis. EGFL7 is tightly associated with the extracellular matrix (ECM), and it supports EC migration either as a single factor or in combination with other ECM molecules. EGFL7 provides a proper microenvironment for endothelial cell migration, thereby enabling accurate patterning. Our study indicates that the molecular composition of the ECM influences vascular morphogenesis. EGFL7 also regulates vascular tubulogenesis. It inhibits platelet-derived growth factor (PDGF)-BB-induced smooth muscle cell migration and promotes endothelial cells adhesion to the substrate.
References
  • Fitch,M.J. et al., 2004, Dev Dyn. 230 (2):316-24.
  • Schmidt,M. et al., 2007, Novartis Found Symp. 283 :18-28.
  • Campagnolo,L.et al., 2008, Gene Expr Patterns  8 (6):389-96.
  • Picuric,S. et al., 2009, Protein Expr Purif. 68 (1):1-6.
  • Nikolic,I. et al., 2010, J Angiogenes Res. 2 (1): 9. 
  • TOP