Rat VE-Cadherin/CD144 Gene ORF cDNA clone expression plasmid,N terminal OFP tag

Gene

Species

Rat

NCBI Ref Seq

NM_001107407.1

RefSeq ORF Size

2331bp

Gene Synonym

Cdh5

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Rat cadherin 5 Gene ORF cDNA clone expression plasmid,N terminal OFP tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-N-OFPSpark

Restriction Site

Protein Tag

OFPSpark

Tag Sequence

GATAGCACTGAG……CACCTGTTCCAG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

OFPSpark Tag Information

OFPSpark is a red (orange) fluorescent protein (excitation/emission maxima are 549 and 566 nm, respectively) derived from DsRed. Possessing high photostability and pH stability, OFPSpark is more than twice brighter than mOrange2. Fast OFPSpark maturation makes it clearly detectable in mammalian cells as early as within 8 hrs after transfection. OFPSpark can be expressed and detected in a wide range of organisms. Mammalian cells transiently transfected with OFPSpark expression vectors produce bright fluorescence in 8 hrs after transfection. No cytotoxic effects or visible protein aggregation are observed. For its monomer structure, OFPSpark performs well in some fusions and protein labeling applications.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

Cadherins (Calcium dependent adhesion molecules) are a class of transmembrane proteins. Cadherin-5, also known as VE-cadherin, CDH5 and CD144, an endothelial specific cell-cell adhesion molecule, plays a pivotal role in the formation, maturation and remodeling of the vascular wall. VE-Cadherin is widely considered to be specific for vascular endothelia in which it is either the sole or the predominant cadherin, often co-existing with N-cadherin. This specificity of VE-cadherin for vascular endothelial cells is important not only in blood and lymph vessel biology and medicine, but also for cell-type-based diagnoses, notably those of metastatic tumors. As a classical cadherin, VE-Cadherin links endothelial cells together by homophilic interactions mediated by its extracellular part and associates intracellularly with the actin cytoskeleton via catenins. Mechanisms that regulate VE-cadherin-mediated adhesion are important for the control of vascular permeability and leukocyte extravasation. In addition to its adhesive functions, VE-Cadherin regulates various cellular processes such as cell proliferation and apoptosis and modulates vascular endothelial growth factor receptor functions. Consequently, VE-cadherin is essential during embryonic angiogenesis.

References

Taveau JC, et al. (2008) Structure of artificial and natural VE-cadherin-based adherens junctions. Biochem Soc Trans. 36(Pt 2): 189-93.

Vestweber D. (2008) VE-cadherin: the major endothelial adhesion molecule controlling cellular junctions and blood vessel formation. Arterioscler Thromb Vasc Biol. 28(2): 223-32.

Gavard J. (2009) Breaking the VE-cadherin bonds. FEBS Lett. 583(1): 1-6.

Vestweber D, et al. (2009) Cell adhesion dynamics at endothelial junctions: VE-cadherin as a major player. Trends Cell Biol. 19(1): 8-15.

Boda-Heggemann J, et al. (2009) Beyond vessels: occurrence and regional clustering of vascular endothelial (VE-)cadherin-containing junctions in non-endothelial cells. Cell Tissue Res. 335(1): 49-65.

Catalog Number:MGI340-NO