Mouse Vasorin Gene ORF cDNA clone expression plasmid,N terminal Myc tag

Catalog Number:MGI325-NM

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
2022bp
Gene Synonym
Atia; Slitl2; 2610528G05Rik
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Mouse vasorin Gene ORF cDNA clone expression plasmid,N terminal Myc tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-Myc
Restriction Site
Protein Tag
Myc
Tag Sequence
GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Vasorin is a typical type I membrane protein. It contains 1 EGF-like domain, 1 fibronectin type-III domain, 10 LRR (leucine-rich) repeats, 1 LRRCT domain and 1 LRRNT domain. Vasorin is predominantly expressed in vascular smooth muscle cells, and that its expression is developmentally regulated. vasorin It directly binds to transforming growth factor (TGF)-β and attenuates TGF-β signaling in vitro. This suggests that down-regulation of vasorin expression contributes to neointimal formation after vascular injury and that vasorin modulates cellular responses to pathological stimuli in the vessel wall.
References
  • Gerhard DS, et al. (2004) The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC). Genome Res. 14(10B):2121-7.
  • Kim W, et al. (2011) Systematic and quantitative assessment of the ubiquitin-modified proteome. Mol Cell. 44(2):325-40.
  • Lee KA, et al. (2011) Ubiquitin ligase substrate identification through quantitative proteomics at both the protein and peptide levels. J Biol Chem. 286(48):41530-8.
  • TOP